ID: 1189112781

View in Genome Browser
Species Human (GRCh38)
Location X:38310647-38310669
Sequence GCTACTTGGATCACCTTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189112774_1189112781 10 Left 1189112774 X:38310614-38310636 CCCGTGAGAACCACAGTATGCTC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1189112781 X:38310647-38310669 GCTACTTGGATCACCTTCTCCGG 0: 1
1: 0
2: 3
3: 10
4: 103
1189112773_1189112781 19 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112781 X:38310647-38310669 GCTACTTGGATCACCTTCTCCGG 0: 1
1: 0
2: 3
3: 10
4: 103
1189112776_1189112781 0 Left 1189112776 X:38310624-38310646 CCACAGTATGCTCTCCACCACAG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1189112781 X:38310647-38310669 GCTACTTGGATCACCTTCTCCGG 0: 1
1: 0
2: 3
3: 10
4: 103
1189112775_1189112781 9 Left 1189112775 X:38310615-38310637 CCGTGAGAACCACAGTATGCTCT 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1189112781 X:38310647-38310669 GCTACTTGGATCACCTTCTCCGG 0: 1
1: 0
2: 3
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189112781 Original CRISPR GCTACTTGGATCACCTTCTC CGG Exonic