ID: 1189115282

View in Genome Browser
Species Human (GRCh38)
Location X:38335937-38335959
Sequence CAGACTTAACACTCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189115282_1189115289 26 Left 1189115282 X:38335937-38335959 CCCCTTTTAGAGTGTTAAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1189115289 X:38335986-38336008 CAGAAAAGAAATGTCCTTGAAGG 0: 1
1: 0
2: 6
3: 34
4: 408
1189115282_1189115287 -9 Left 1189115282 X:38335937-38335959 CCCCTTTTAGAGTGTTAAGTCTG 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1189115287 X:38335951-38335973 TTAAGTCTGTTGGGTTTCTTTGG 0: 1
1: 0
2: 2
3: 30
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189115282 Original CRISPR CAGACTTAACACTCTAAAAG GGG (reversed) Intronic
902541107 1:17155447-17155469 CAGACTTAACATCCAAAAACTGG + Intergenic
906269510 1:44464105-44464127 CTGACATAGGACTCTAAAAGTGG - Intronic
907648073 1:56264228-56264250 TAGACTTTGCCCTCTAAAAGTGG + Intergenic
909247336 1:73303094-73303116 TAGACTTGAGACTCTAAAATCGG + Intergenic
911602235 1:99857886-99857908 CAGACTTAAAAAACTAAAACAGG - Intronic
911774286 1:101787918-101787940 ATAATTTAACACTCTAAAAGTGG - Intergenic
912394886 1:109334874-109334896 GAAAGTTAACACTCTAAAAAGGG + Intronic
919131811 1:193460517-193460539 CAGACTTCCAACTCTATAAGGGG - Intergenic
1071689186 10:87797523-87797545 AAAACAGAACACTCTAAAAGGGG - Intronic
1072483896 10:95835766-95835788 CAGAGTAAACACACAAAAAGTGG - Intronic
1073948615 10:108781981-108782003 CAACCTTAACATTTTAAAAGAGG + Intergenic
1075303942 10:121350877-121350899 CAGACTTTACATTCTAGTAGGGG - Intergenic
1076089221 10:127666345-127666367 CAGAGGAAACACACTAAAAGTGG + Intergenic
1081353404 11:42083685-42083707 CAGACTTGACCCTCAAAGAGGGG + Intergenic
1081370052 11:42289626-42289648 CAGACTTCTCACTGTAAGAGTGG - Intergenic
1085068435 11:73519426-73519448 CAGAGTTTACACTCTAGAGGAGG + Intronic
1085979455 11:81706053-81706075 CAGACTGAACAGTCTAATACAGG - Intergenic
1086453703 11:86941520-86941542 CAAGCTTAAAACTCTAAATGTGG - Intronic
1090101027 11:123797044-123797066 CAGACTTAACATCCAAAAACTGG + Intergenic
1090132125 11:124154744-124154766 CTGACCTAACACAATAAAAGTGG - Intergenic
1095430119 12:42125010-42125032 CAGAGTTAACGGTCTAGAAGTGG + Intronic
1096081038 12:48832652-48832674 CAGACTAAAGAATCTAAAATGGG + Intronic
1097848293 12:64388236-64388258 CAAACAAAACACTTTAAAAGGGG - Intronic
1098584674 12:72141897-72141919 CCAATTTATCACTCTAAAAGAGG - Intronic
1100522660 12:95390222-95390244 AAGACAGAACACCCTAAAAGGGG - Intergenic
1107705479 13:43098992-43099014 AAGACTTAACACTGTTAAAATGG - Intronic
1109675699 13:65673409-65673431 TAGACTTAACACAATAATAGTGG - Intergenic
1109678324 13:65711280-65711302 CAGATTTAAAAATCTAAAAATGG + Intergenic
1112304997 13:98265831-98265853 CAGACTTCACAGTCTGATAGAGG + Intronic
1112657918 13:101472877-101472899 AAGAATTAAAACTCTAAAAATGG + Intronic
1117357816 14:54942900-54942922 AAGACTTTACACTGCAAAAGAGG - Intronic
1117573784 14:57077071-57077093 TAAACATAACACTCTAAGAGTGG + Intergenic
1118054149 14:62061748-62061770 AAGACGTAACAAACTAAAAGGGG + Intronic
1120303103 14:82733275-82733297 TAGACTTAACACTCAGAATGTGG - Intergenic
1120754236 14:88227162-88227184 CAGAAATATCACTCTAAAATAGG + Intronic
1122275448 14:100588499-100588521 CAAACTGTACACTTTAAAAGTGG - Intergenic
1123042480 14:105496073-105496095 CCGACTTACCGCCCTAAAAGGGG - Intronic
1125501941 15:40245386-40245408 CAGAGTTAAAACTTTAAAACCGG + Intronic
1126226585 15:46277820-46277842 CAGACATAACACATTAAATGTGG - Intergenic
1130684017 15:86021411-86021433 CAGACATAACATTCCAGAAGGGG - Intergenic
1131907605 15:97160747-97160769 AAGACTTAAAACTCTAAGAGGGG - Intergenic
1132926541 16:2432637-2432659 CAGGGGAAACACTCTAAAAGGGG - Intronic
1133466964 16:6036648-6036670 CAGACTAAAACATCTAAAAGTGG - Intronic
1137276337 16:46936406-46936428 CAGTGTTAACACTGTAAAACGGG + Intergenic
1138223266 16:55271059-55271081 GAGAATTAAAACTTTAAAAGGGG - Intergenic
1139556034 16:67711070-67711092 CAGAATGAAGACTCCAAAAGAGG + Intronic
1140155301 16:72418680-72418702 CTGACTTAACACTCTGACAGAGG + Intergenic
1141759552 16:86018861-86018883 CAAACATAACACTCCAAAAGTGG - Intergenic
1146505487 17:33401071-33401093 CCGTCTCAACACTCTAACAGAGG + Intronic
1149096332 17:52845313-52845335 CATAGTTAACACTCCAATAGGGG - Intergenic
1150681532 17:67288508-67288530 CAGACTGTACACTGTACAAGTGG + Intergenic
1151246854 17:72801910-72801932 CAGACAAAACACTCTATAATAGG + Intronic
1151824773 17:76518111-76518133 CAGACTTCAGACTCTAGCAGGGG - Intergenic
1153682704 18:7515438-7515460 GAGACTGAACACTCAAACAGAGG - Intergenic
1158561484 18:58517311-58517333 CACACTTAACCCTTCAAAAGAGG + Intronic
1158844380 18:61426268-61426290 CAAACTTAAAGCTCTAAAACAGG + Intronic
1160364768 18:78314465-78314487 CAGGCTGAACACTCTATCAGGGG + Intergenic
927085083 2:19667065-19667087 CAAACTTAAAACTGGAAAAGTGG + Intergenic
936548910 2:113417624-113417646 CACACTGAACACTCAAAAATGGG + Intergenic
937076756 2:119112876-119112898 CAGTGTTAAGACTCTCAAAGGGG - Intergenic
940929166 2:159406532-159406554 AATACTTCAAACTCTAAAAGTGG + Intronic
943182765 2:184564374-184564396 CAGACTTGGCACTGTACAAGTGG + Intergenic
943420492 2:187662225-187662247 CATACATAACACTCGGAAAGAGG - Intergenic
943672080 2:190673743-190673765 CAACCGTGACACTCTAAAAGAGG - Intronic
943751982 2:191519102-191519124 CAGAGTTTTCACTCTCAAAGAGG + Intergenic
944689101 2:202143385-202143407 CTGATTTAACATTTTAAAAGTGG + Intronic
945720881 2:213416933-213416955 CAGACTTAACAGTTTAGAATTGG + Intronic
946639250 2:221765806-221765828 CAGTCTTAACACATTTAAAGTGG + Intergenic
947039285 2:225896824-225896846 CAGATGTACCACTCTACAAGGGG + Intergenic
948576293 2:238952375-238952397 CATTCTTAAAACTCTAGAAGAGG - Intergenic
1178271114 21:31190794-31190816 CTGACTGAACACACTTAAAGCGG - Intronic
1178490342 21:33046753-33046775 CAAAATTAACACTTTAAAAGAGG - Intergenic
1179540291 21:42079353-42079375 AGGTGTTAACACTCTAAAAGTGG - Intronic
1183134890 22:35877956-35877978 CAGACAAAAAACTCTAAAAGAGG + Intronic
949651044 3:6159840-6159862 CAGACTTAACACTTTAAAAATGG - Intergenic
949752071 3:7364629-7364651 CAGAATTATCAGTATAAAAGAGG - Intronic
950763387 3:15254993-15255015 CAGAATTAACAGTTTGAAAGAGG + Exonic
951488350 3:23239925-23239947 CAGAAATTACACTTTAAAAGAGG - Intronic
952516155 3:34106357-34106379 CAGATTTGACTCCCTAAAAGAGG - Intergenic
954448550 3:50559481-50559503 CTGACTTTAGACTCTAAGAGAGG - Exonic
954505817 3:51071827-51071849 CAAACTTCACTCTCAAAAAGAGG - Intronic
954966405 3:54615087-54615109 CTGACTTAACAGTGCAAAAGAGG + Intronic
955860226 3:63321694-63321716 CAGACTTTACTCCCTAAAGGAGG - Intronic
957144748 3:76409721-76409743 CAGCCTTCACATTGTAAAAGGGG + Intronic
957543897 3:81612189-81612211 TGGATTTAACACTGTAAAAGTGG - Intronic
960492038 3:118328848-118328870 CATACTTAGCATTCTAATAGTGG + Intergenic
964130654 3:153282452-153282474 CAGACTTAGCATCCTAAAAATGG + Intergenic
966154332 3:176899622-176899644 AAGACATGACATTCTAAAAGTGG - Intergenic
971450067 4:26791804-26791826 CAGACTTAATACACTCAAAAAGG - Intergenic
972927058 4:44022599-44022621 CAGACTTAGCCATCTAAAATGGG - Intergenic
973299523 4:48564491-48564513 CAGACTTCACAATTTAAAATAGG - Intronic
975481619 4:74887043-74887065 CAGAATTAACAGTGTAAAAATGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977158474 4:93604261-93604283 CAGGCTTAACACTTTAGTAGAGG + Intronic
978203725 4:106053732-106053754 CAAACTTAACAGTTTCAAAGGGG + Intronic
981260975 4:142718454-142718476 CATACTTAACTCTCTAGAAGGGG - Intronic
981509728 4:145542722-145542744 CAAACTTTAGACTCTAAAAAAGG - Intronic
984428769 4:179622069-179622091 GAGACTTAACCCTCAAACAGAGG + Intergenic
994725599 5:103431691-103431713 AAGAAATAACACTCTAAAAGTGG - Intergenic
995818405 5:116198478-116198500 CAAACATATCACTCTAATAGGGG - Intronic
996044676 5:118857852-118857874 TAGAATTAACACTTGAAAAGTGG + Intronic
998752497 5:145338664-145338686 CAGAGTAAAGACTCAAAAAGTGG - Intergenic
999373719 5:151071868-151071890 CAGAATTCACACTGCAAAAGAGG + Intronic
1000958096 5:167565913-167565935 CAGACTAATCACTGGAAAAGTGG + Intronic
1007013971 6:38444139-38444161 CAGGCTTAACCATCTAGAAGAGG + Intronic
1010922373 6:81699060-81699082 CAGACATAAACCTCAAAAAGAGG - Intronic
1012626288 6:101407316-101407338 TAAACTTAAGACTCTAAACGTGG - Intronic
1013701031 6:112769876-112769898 CAGGCTCAAGACTCAAAAAGAGG + Intergenic
1013749391 6:113385669-113385691 AAGACTTAACAATCCAACAGTGG + Intergenic
1016012013 6:139147022-139147044 CCTACTAAACACTCAAAAAGGGG - Intronic
1016327797 6:142922730-142922752 CAGACTTACGACTGGAAAAGAGG - Intronic
1021984473 7:26085529-26085551 CACCCTTAACATTTTAAAAGTGG - Intergenic
1030504765 7:110407477-110407499 CAGAATTAACACTTTAAAACCGG - Intergenic
1030864134 7:114677948-114677970 CAGAGGTAAAACTCTAATAGAGG + Intronic
1031070460 7:117155789-117155811 CAGAGTTTAAACTCTAAAAGTGG + Intronic
1031733460 7:125327065-125327087 TAGAATTAACACTCTCTAAGAGG + Intergenic
1033714841 7:143989650-143989672 CAGACTTAACATCCAAAAACTGG - Intergenic
1035152033 7:156882730-156882752 CACACTTAAAACTTTAAGAGGGG + Intronic
1042929935 8:74003266-74003288 CAGACTTAACATCCAAAAACTGG + Intronic
1044684560 8:94814438-94814460 CATAATTATCACTATAAAAGGGG + Intronic
1046023013 8:108688958-108688980 CAGACTTGACACTAGAGAAGAGG - Intronic
1049904032 9:199226-199248 CACACTGAACACTCAAAAATGGG - Intergenic
1052128937 9:24816569-24816591 CAGACTTACCTCTCAACAAGAGG - Intergenic
1052392351 9:27894977-27894999 CAGACTCATCTCTCTAAGAGCGG - Intergenic
1053326702 9:37160046-37160068 CAGCCTTAAGAGTCAAAAAGAGG - Intronic
1053510308 9:38682040-38682062 GAAATTTAACCCTCTAAAAGTGG + Intergenic
1054480242 9:65655832-65655854 CACACTGAACACTCAAAAATGGG + Intergenic
1054681302 9:68221754-68221776 CACACTGAACACTCAAAAATGGG + Intergenic
1055062742 9:72087483-72087505 AAGACTTAAAATTTTAAAAGAGG + Intergenic
1057066314 9:92055314-92055336 CAGACGTTATACACTAAAAGCGG + Intronic
1058551558 9:106120760-106120782 CAGACTTAGCACTCTACATATGG - Intergenic
1059397077 9:114042108-114042130 CAGACTTTACATTCACAAAGGGG - Intronic
1202783174 9_KI270718v1_random:20307-20329 CACACTGAACACTCAAAAATGGG - Intergenic
1187413673 X:19073447-19073469 CAGAGTTCACAACCTAAAAGGGG - Intronic
1187776421 X:22763929-22763951 CAGAATTCACAGTCTATAAGTGG + Intergenic
1189115282 X:38335937-38335959 CAGACTTAACACTCTAAAAGGGG - Intronic
1192753166 X:74016270-74016292 CAGAGTTACCATTCTTAAAGAGG + Intergenic
1194025313 X:88744482-88744504 CATACTAAATACTATAAAAGGGG - Intergenic
1195413443 X:104594479-104594501 CAGACCCAACACACTAAAAGGGG + Intronic
1195806060 X:108767172-108767194 AAGATTTAATATTCTAAAAGTGG - Intergenic
1196313902 X:114200406-114200428 CAGACTTTTCATTCCAAAAGGGG + Intergenic
1197133923 X:123038639-123038661 CATACATAACTCTATAAAAGGGG - Intergenic
1197259042 X:124296936-124296958 ATGACCTAACACTTTAAAAGAGG + Intronic
1199810854 X:151347105-151347127 CATACTGAACACTCTAACAGAGG - Intergenic