ID: 1189116364

View in Genome Browser
Species Human (GRCh38)
Location X:38347068-38347090
Sequence CTAGTTCAGAACCTATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189116364 Original CRISPR CTAGTTCAGAACCTATTTAT TGG (reversed) Intronic
900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG + Intronic
900893334 1:5465447-5465469 CTAGTACAGAACCTCTCTAATGG - Intergenic
906358478 1:45130251-45130273 CTATTAAAGAACCTATTAATAGG + Intronic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
908805471 1:67926787-67926809 CTAGTTTAGAAGTTATTTAAAGG - Intergenic
909247631 1:73307866-73307888 CTAAGTCAGAAACTGTTTATAGG + Intergenic
910954375 1:92685871-92685893 CAATTTCAGAACCTGTTAATTGG - Intronic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
912735087 1:112143380-112143402 CTAAATCAGAATCTATTAATAGG - Intergenic
918322341 1:183376230-183376252 TTAGTTGAGAACCTATTAAGTGG + Intronic
919090780 1:192976923-192976945 GCAGCTCAGAACCTATTTTTGGG - Intergenic
921901858 1:220459682-220459704 CAAGTTCAGGAGCTATTGATGGG - Intergenic
1063889626 10:10616354-10616376 CAAATTCAGAACCTATTGGTTGG + Intergenic
1065742225 10:28807474-28807496 CATGTTCCTAACCTATTTATGGG + Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1067666797 10:48286006-48286028 CTTGTTCAGGACCTATCTGTGGG + Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1069124792 10:64617101-64617123 GTAGTTTAGAATCTATTTGTGGG + Intergenic
1069783354 10:70970686-70970708 CTAGTTCTGTAGGTATTTATGGG - Intergenic
1072417786 10:95263301-95263323 CCAGATCAGAACCTATTCCTAGG + Intronic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1073738311 10:106376732-106376754 CTAATTCAAAGCCTATTTAAAGG + Intergenic
1077558865 11:3243268-3243290 CTAGTTTAGAGGCTATTTAAGGG - Intergenic
1079680819 11:23295452-23295474 CTAGTTCAGCTCCTTTTTACTGG - Intergenic
1079992230 11:27258223-27258245 CTCATTCAGCACCTATTGATTGG - Intergenic
1080087339 11:28300067-28300089 CTAGGTCAGATCACATTTATAGG + Intronic
1082737131 11:56868593-56868615 CTAATTCAGAGCTTATTTAAAGG + Intergenic
1087294471 11:96354552-96354574 ATAGTTCAGCAACTAGTTATGGG + Intronic
1088713468 11:112528419-112528441 CTATTTCAGATCCTTTTAATAGG - Intergenic
1088834095 11:113562571-113562593 CTACTTCAGAACCTCTTACTTGG - Intergenic
1088966525 11:114727690-114727712 CTATTTCAGAAATTATTTACTGG + Intergenic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1092993791 12:13928425-13928447 CTAATTCAGAAGATATTTAAAGG + Intronic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1097574603 12:61375786-61375808 CAAGTTCAGAAATTATGTATAGG - Intergenic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1106850721 13:33787724-33787746 CTTATTCACAACCTCTTTATTGG - Intergenic
1108301719 13:49084061-49084083 CTAGTTGATATACTATTTATAGG - Intronic
1110937549 13:81310963-81310985 CTAGTGCAGAAATTATTTTTTGG + Intergenic
1111352961 13:87056654-87056676 CTATTTCAGAGACCATTTATTGG - Intergenic
1111460663 13:88537365-88537387 ATAGTTTAGAAACTATCTATTGG - Intergenic
1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG + Intergenic
1117187687 14:53258009-53258031 CTAGTTCAAAGCTTATTTAAAGG - Intergenic
1118156427 14:63246881-63246903 CTAGATCACAACCTGTTTACAGG + Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1121750040 14:96345360-96345382 CTGGTTCTGAGCCTATGTATTGG - Exonic
1125188366 15:36959470-36959492 TTAGTTCAACACGTATTTATTGG - Intronic
1125418395 15:39477178-39477200 GAAGTTTAGAATCTATTTATGGG - Intergenic
1126193832 15:45908779-45908801 CTAATTCAGAAATTATTTAAAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1139159602 16:64488503-64488525 CTATTACAGAACCCTTTTATTGG - Intergenic
1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG + Intergenic
1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG + Intergenic
1149380433 17:56088227-56088249 CTAGTTCAGAACATATTCCCTGG + Intergenic
1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG + Intergenic
1152674861 17:81634545-81634567 CTAATTCCTAACCTATTTCTAGG + Intronic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG + Intergenic
1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG + Intergenic
926451073 2:13004787-13004809 CTAGCACAGAACTTATTTCTGGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928818625 2:35331672-35331694 CTAATTCAGAGGCTATTTAAAGG + Intergenic
930932049 2:56897298-56897320 ATAATTCAGAACTTCTTTATGGG + Intergenic
931220702 2:60285838-60285860 CCACTTCAGAAGCTTTTTATGGG + Intergenic
931226041 2:60333161-60333183 CTAGGTAAGAAAATATTTATTGG - Intergenic
935915629 2:107946734-107946756 TAACTTCTGAACCTATTTATGGG - Intergenic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
939855609 2:147355197-147355219 ATATTTCAGAATCTATTTCTGGG + Intergenic
940756259 2:157686540-157686562 CTAGTACAATACCTATTTCTTGG - Intergenic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
943278011 2:185893015-185893037 CTTTTTCAGCACCTGTTTATTGG - Intergenic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
947023750 2:225713594-225713616 CAATTTCAGAGCCTGTTTATTGG - Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947202719 2:227629246-227629268 CTATTTCATAAACTATTTTTTGG - Intronic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
1173091568 20:39976961-39976983 CTTGTTCAGAAAATATTTGTTGG - Intergenic
1174814801 20:53677523-53677545 GTTGTTCAGAAGCTATTAATAGG + Intergenic
949716381 3:6936259-6936281 CTATTACAGAACCTCTTGATGGG - Intronic
950481325 3:13246060-13246082 CTCTTTCAGAAACTATTTGTGGG + Intergenic
959855502 3:111151251-111151273 CTCATTCAAAACCTGTTTATCGG - Intronic
960150398 3:114243377-114243399 CTATTTCTGAACCTTTTTAGTGG - Intergenic
967222909 3:187263622-187263644 TTAATACAGAAACTATTTATTGG + Intronic
969143301 4:5099071-5099093 CTAGGGGAGAACCTATTCATTGG + Intronic
969159544 4:5244243-5244265 CAATTTCAGAGCCTGTTTATTGG + Intronic
969187596 4:5488853-5488875 CTAATTCAGAGGCTATTTAGAGG - Intronic
969881342 4:10176738-10176760 CTAGATCAGAAACTTTTAATTGG + Intergenic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
974667729 4:64986829-64986851 CAAGTTCAGAACCAATTGAGAGG + Intergenic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
981229089 4:142331961-142331983 CTGGTTATGAGCCTATTTATGGG - Intronic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
981602179 4:146502413-146502435 CTACATCAGAAGCTATTTATAGG + Intronic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
993536270 5:89090389-89090411 CCAGTTCATAAATTATTTATTGG + Intergenic
996608750 5:125354446-125354468 CTAGTCCTGGACCTATTTGTTGG + Intergenic
1007355311 6:41310744-41310766 CTAGTTCAAAATGTATTTGTGGG - Intergenic
1008348748 6:50462582-50462604 CCAGTTAAGAACTGATTTATAGG - Intergenic
1009321311 6:62292809-62292831 CTAGTTCAGAACCTAGGTGGAGG + Intergenic
1009680711 6:66888280-66888302 ACAGTTCAGAACCAATTGATTGG + Intergenic
1011735470 6:90306039-90306061 CCAGGTCAGATCCTCTTTATAGG + Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1018410311 6:163538579-163538601 CGAGATGAGAAGCTATTTATTGG + Intronic
1019997899 7:4736712-4736734 CCAGTTCAAAACCTGATTATGGG - Intronic
1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG + Intronic
1022462857 7:30627734-30627756 CTTGTTCAGAACCAAATTACTGG - Intronic
1024906730 7:54391210-54391232 CTAATTCAAAACTTATTTAAAGG - Intergenic
1029594448 7:101529639-101529661 CTTGTTCAGCTCCTACTTATAGG + Intronic
1032976144 7:137225558-137225580 CTTCTTCACAACCTATATATAGG + Intergenic
1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG + Intergenic
1041165016 8:55083008-55083030 TTAGTATATAACCTATTTATAGG + Intergenic
1045815842 8:106274910-106274932 CTGGTTCAAACCATATTTATTGG - Intronic
1049524248 8:143113296-143113318 CTAGTTTGGAAGCTATTTACAGG - Intergenic
1050739488 9:8803844-8803866 CATGTGCAAAACCTATTTATTGG + Intronic
1051180016 9:14401529-14401551 CTTGTTGAGTAACTATTTATAGG - Intergenic
1052102082 9:24460637-24460659 CTAGTTCAGACCCAATTCAGGGG - Intergenic
1052278406 9:26704789-26704811 GTAATACAGAAGCTATTTATAGG - Intergenic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1059598167 9:115745661-115745683 TTGGTACAGAACCTTTTTATAGG + Intergenic
1187741575 X:22361833-22361855 CTAGCTCTGTATCTATTTATGGG + Intergenic
1188876591 X:35438093-35438115 CTAATTCAGAGCTTATTTAAAGG - Intergenic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189969569 X:46404612-46404634 CAGGTTCATAACCTATTTACTGG - Intergenic
1192220770 X:69196004-69196026 CCAGTTCAGAATCTATTAATAGG - Intergenic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1194324283 X:92493523-92493545 CTAGGTCAAAACCCATTTTTAGG + Intronic
1194675322 X:96787305-96787327 TTAGTTCAAAATCCATTTATTGG - Intronic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1198897029 X:141466779-141466801 CTATTTCAGAACCTACTTGTGGG - Intergenic
1199068086 X:143443929-143443951 CTAGTCCAGAATATAATTATAGG + Intergenic
1199538574 X:148931771-148931793 CTAGTTCAGAACACCATTATGGG + Intronic
1200633025 Y:5612744-5612766 CTAGGTCAAAACCCATTTTTAGG + Intronic
1202064909 Y:20928577-20928599 CTAGGTCAGTACCTCTTTTTTGG - Intergenic