ID: 1189116720

View in Genome Browser
Species Human (GRCh38)
Location X:38350527-38350549
Sequence TGACATAATCAGCAGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189116717_1189116720 4 Left 1189116717 X:38350500-38350522 CCTGTAAAGTAAAACAGACTCCA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1189116720 X:38350527-38350549 TGACATAATCAGCAGAAGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189116720 Original CRISPR TGACATAATCAGCAGAAGCT GGG Intronic
900213516 1:1468713-1468735 TGACAGAAAAGGCAGAAGCTGGG + Exonic
900221078 1:1509529-1509551 TGACAGAAAAGGCAGAAGCTGGG + Intergenic
903418425 1:23200878-23200900 TGACAGCAGCAGCAGAAGCAAGG + Intergenic
903571204 1:24306895-24306917 TGATACAAGCAGCAGAGGCTGGG - Intergenic
903796195 1:25930688-25930710 TCACATCATCACCAGAAGGTAGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
909344624 1:74571420-74571442 TGACATATACAACAGAGGCTGGG - Exonic
915528274 1:156489273-156489295 TGAAATAAGCAGCAGGCGCTGGG + Intronic
916592292 1:166204291-166204313 TGATACAATCAGCAGAGACTGGG - Intergenic
917138375 1:171809893-171809915 GGACATAGACAGCAGAAGCCAGG + Intronic
1063796542 10:9519291-9519313 TGACATAGTCATCAAAAGTTTGG - Intergenic
1070436479 10:76398546-76398568 TGGCCCAATCAGCAGAGGCTTGG - Intronic
1070548281 10:77470014-77470036 TGACAGAAGGAGCAGAATCTTGG - Intronic
1074663512 10:115690744-115690766 AGACCTAAGCAGCAGCAGCTGGG - Intronic
1076317380 10:129551996-129552018 TGGGATAATGATCAGAAGCTTGG + Intronic
1077535403 11:3121741-3121763 AGACATAATCAGGTGAAGATGGG + Intronic
1080459360 11:32439515-32439537 TGAAATGATCAGAAGAAGCTGGG - Intergenic
1080605091 11:33859086-33859108 TGACATGATTAGCAGAAGAAAGG - Exonic
1083046249 11:59738014-59738036 AGAAATAATCAGCAGAGGCCAGG - Intronic
1083969815 11:66068078-66068100 TGAGAAAGGCAGCAGAAGCTAGG + Intronic
1085253136 11:75156562-75156584 TAACATCAGCAGCAGATGCTGGG - Intronic
1085573605 11:77582272-77582294 TGACAAAAACAGCACAGGCTGGG - Intronic
1085779422 11:79394913-79394935 TGTCACAATCACCAGAAGCCAGG + Intronic
1086605600 11:88692745-88692767 TGACATCTTCAGGAGTAGCTGGG - Intronic
1088713059 11:112525476-112525498 TCACAGAATCAGCAGAGCCTGGG + Intergenic
1091212283 11:133872297-133872319 TGACATAATCACCAAAGGCAAGG + Intergenic
1092991923 12:13911469-13911491 TGACACAAACTGCAGAGGCTGGG - Intronic
1093374785 12:18411594-18411616 TGACACACTCAGCATCAGCTTGG - Intronic
1093647949 12:21610468-21610490 TGAAATAATCAGCTGGAGCTGGG + Intergenic
1096245224 12:49981130-49981152 TCACATATTTAGCAAAAGCTGGG + Intronic
1096340339 12:50793064-50793086 TGCCATAATCAGGAGAAGAAAGG - Intronic
1098959120 12:76719768-76719790 TGAAATAAACAGCAGTAGCCAGG + Intergenic
1099059222 12:77884809-77884831 TGAAATAATCAGGAGTACCTGGG - Intronic
1099663130 12:85591929-85591951 TGAGAAAATTAGCAGAAGCTGGG + Intergenic
1099880439 12:88460939-88460961 TGCCAGAACCACCAGAAGCTAGG - Intergenic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1101886717 12:108670293-108670315 TGAGATCAGCAGCAGAAACTGGG + Intronic
1104598531 12:130136752-130136774 TGCCACAACCAGCAGAAACTAGG + Intergenic
1104670564 12:130677220-130677242 TGACATAATCATCATATGCTTGG - Intronic
1112606420 13:100910950-100910972 AGAAATAATCAGCAGTAGGTAGG + Intergenic
1112910587 13:104478458-104478480 TGACATAATTACCGGACGCTGGG - Intergenic
1115591349 14:34868501-34868523 TGACATAAAAATCAGAAACTAGG + Intronic
1116171638 14:41409709-41409731 TAACATTACCAGCAGAAACTGGG - Intergenic
1117378771 14:55139235-55139257 AGACATAATCAGTAGATTCTGGG - Intronic
1118396492 14:65341470-65341492 TTACATATTTAGCAGAATCTTGG - Intergenic
1118909574 14:70050000-70050022 TGGCATAACCGGTAGAAGCTGGG + Intronic
1120811004 14:88803405-88803427 TGGCACAACCACCAGAAGCTAGG + Intergenic
1121171151 14:91855409-91855431 TTACATGACCAACAGAAGCTAGG - Intronic
1121479389 14:94250622-94250644 TCACATAATTAACAGAATCTGGG + Intronic
1122349930 14:101083195-101083217 TGTCCTAATCCCCAGAAGCTGGG + Intergenic
1124628019 15:31320698-31320720 TTACATAATCACCAGAAACTGGG + Intergenic
1126333628 15:47562364-47562386 TGAGAAAATCTGCATAAGCTTGG + Intronic
1126829210 15:52582766-52582788 TGCTATAATCAGCAGTGGCTAGG + Intronic
1128159661 15:65415318-65415340 TGACATACCCAGCAGCTGCTCGG - Intronic
1129730041 15:77925294-77925316 TGCCATGATCAGCAGCTGCTGGG + Intergenic
1131482916 15:92797454-92797476 TGAAATAATGAGTAAAAGCTAGG - Intronic
1135891252 16:26359481-26359503 TGTCAAAATCAGAAGAAGATGGG + Intergenic
1135915876 16:26605033-26605055 TCACATCATCACCAGATGCTGGG - Intergenic
1139385814 16:66569548-66569570 TGAGATAATCAGCAGCTGTTTGG + Intronic
1144991953 17:19238885-19238907 TTACATAATGAGAGGAAGCTTGG - Intronic
1147518485 17:41144738-41144760 TGAAATAATCAGTAGAGACTTGG + Intergenic
1149765653 17:59275275-59275297 ATACATAATCAGCAGCAGCCAGG + Intronic
1149801713 17:59574365-59574387 TCAGATAATCAGAAAAAGCTAGG - Intronic
1149844774 17:60001097-60001119 TCAGATAATCAGAAAAAGCTAGG + Intergenic
1150571791 17:66393310-66393332 GAACAAAATCATCAGAAGCTGGG - Intronic
1150728082 17:67667608-67667630 TGAAATAATCAGCAAATGATTGG + Intronic
1156327438 18:36086637-36086659 AGAAATAATCAGCAGAAGGCTGG + Intergenic
1157241845 18:46017916-46017938 TGAAAAAATCAGGAGAGGCTGGG - Intronic
926056621 2:9777562-9777584 GGAAACATTCAGCAGAAGCTGGG - Intergenic
929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG + Intergenic
933049730 2:77588799-77588821 TGACATTATCAACATAAGGTAGG - Intronic
935012202 2:99145687-99145709 TGTCCTAATCCCCAGAAGCTGGG - Intronic
935038221 2:99399777-99399799 TCACAAAATCTGCAGAAGCTTGG - Exonic
937753110 2:125501814-125501836 TTACAGAATGAGCAAAAGCTGGG - Intergenic
937876059 2:126826374-126826396 TGGCTTTATCAGCAGCAGCTGGG + Intergenic
939099498 2:137879997-137880019 TGGCTTAATGAGCAGAAGCCGGG + Intergenic
939427014 2:142052151-142052173 TGCCATAATCATGAGAAGTTAGG - Intronic
940710197 2:157153769-157153791 TGGGATAATCAGTAGAAGATAGG - Intergenic
941043050 2:160644845-160644867 TGCCAGCATCACCAGAAGCTAGG + Intergenic
941691830 2:168508259-168508281 TGAAAGAATCAGCAAAATCTGGG + Intronic
941856615 2:170237610-170237632 TGAGATTATTAGAAGAAGCTTGG - Intronic
944444477 2:199775620-199775642 TGCCATTATTAGCAGCAGCTAGG - Intronic
944777914 2:202987894-202987916 TGAAATCATCAGCATAAGCAAGG + Intronic
947324838 2:228962868-228962890 TGACATACTGAACAGAAGCTGGG + Intronic
1171329140 20:24322143-24322165 TGACATCATCAGCTGACCCTGGG + Intergenic
1172587484 20:36094698-36094720 TGCCAAAAGCAGCAGAGGCTGGG + Intronic
1172786767 20:37473636-37473658 AGACATAGTGAGCAGAGGCTGGG - Intergenic
1173535444 20:43808402-43808424 TGACAAAAACAGCACAAGGTAGG - Intergenic
1173773400 20:45683387-45683409 AGACATCATCAGCAGTAGGTGGG - Intergenic
1176894426 21:14359828-14359850 TGAAATACTCAGCTGAAACTGGG + Intergenic
1177053801 21:16273906-16273928 TAACATAACCAACAGATGCTAGG + Intergenic
1178137830 21:29647784-29647806 TGACAGAATTAACAGAAGTTTGG - Intronic
949144532 3:681544-681566 TGACATAATCAGTACATGATAGG - Intergenic
949339479 3:3013349-3013371 TGACATGTTTAGCAAAAGCTAGG + Intronic
951843786 3:27063483-27063505 TGACATAATGAGCAGAAGACTGG - Intergenic
952078007 3:29721973-29721995 TAACATACTCAGCAGTACCTTGG - Intronic
952746372 3:36785326-36785348 TGAAATAATCATAAGAACCTAGG - Intergenic
953209877 3:40866436-40866458 TGACACAATGAGCAGAGGCCTGG + Intergenic
960934939 3:122893287-122893309 TAACAAAATCATCAGAAACTAGG - Intergenic
961380148 3:126491751-126491773 TGGCAAAATGAGCAAAAGCTAGG + Intronic
969438522 4:7202818-7202840 TTACATCAGAAGCAGAAGCTGGG - Intronic
970914373 4:21315646-21315668 TGACATAATTAGTACAAGGTGGG + Intronic
971081702 4:23219961-23219983 TGACATAGTCAGCATGAGGTGGG + Intergenic
972737568 4:41859131-41859153 TGACACAATCAGCTGAATGTGGG + Intergenic
975089330 4:70382679-70382701 TAACATGATCAGGAGAACCTAGG - Intronic
978814046 4:112882730-112882752 TGACAAAATCAACAGAACCTAGG - Intronic
979397232 4:120203163-120203185 TAACACAATCAGCAGATGCTTGG - Intergenic
981114473 4:140973940-140973962 TGACACCATCAGAGGAAGCTGGG - Intronic
984104765 4:175531648-175531670 TCACAGAAACAACAGAAGCTTGG + Intergenic
984223866 4:177010994-177011016 TGACATAATCAACAGCAAGTAGG + Intergenic
984383244 4:179022289-179022311 TGGCATCATAGGCAGAAGCTTGG + Intergenic
984633997 4:182091628-182091650 TGACATTCTCAGCACCAGCTAGG - Intergenic
985887465 5:2690760-2690782 GGAGACCATCAGCAGAAGCTAGG + Intergenic
987160977 5:15142111-15142133 TGACATAATAAGCAAAAGTTGGG - Intergenic
987728734 5:21739521-21739543 TATCAAAATCAGCAGATGCTTGG - Intergenic
988803144 5:34715429-34715451 TGAAATTACCTGCAGAAGCTAGG - Intronic
989774839 5:45192441-45192463 TCACATAATCAGCACAAGGAAGG - Intergenic
990191329 5:53263417-53263439 TATCATAATGAGCAGAAGCTTGG - Intergenic
990533878 5:56700955-56700977 AAACAAAATTAGCAGAAGCTGGG + Intergenic
993295303 5:86130972-86130994 TGACATATTTAGCAGAAGAATGG - Intergenic
993561193 5:89412045-89412067 TTACATAATTTTCAGAAGCTGGG + Intergenic
993608593 5:90026574-90026596 AGACATTTTAAGCAGAAGCTTGG + Intergenic
994364453 5:98896225-98896247 TGACATTAACAGCAGAAACATGG - Exonic
994674871 5:102808092-102808114 TGACATCATCAGGAGAGACTTGG - Intronic
998215858 5:140238265-140238287 TGACAGAATCAGCACAGCCTTGG - Intronic
999157063 5:149465530-149465552 CGAGAAAAGCAGCAGAAGCTAGG - Intergenic
1000231702 5:159321646-159321668 AGACATAATCAGCAGAGGAATGG - Intronic
1006102934 6:31697241-31697263 AGACACAAACTGCAGAAGCTAGG - Intronic
1007405748 6:41635310-41635332 TGACATAAGCAGAAGAAACGAGG + Intergenic
1010739718 6:79486288-79486310 TGTCATAGCCCGCAGAAGCTTGG - Exonic
1011750052 6:90446563-90446585 TGAAAGAAGCAGCAGAAGCCAGG + Intergenic
1012003051 6:93678670-93678692 TAACATAATCAGCAGACACTTGG + Intergenic
1012148373 6:95715231-95715253 TCCGATAATCAGCACAAGCTGGG - Intergenic
1014772756 6:125475669-125475691 TGAAATTATCAGCAAAAGGTTGG - Intergenic
1017306068 6:152919923-152919945 TGAAATAATCAACATATGCTTGG + Intergenic
1017677275 6:156827170-156827192 AGACATAATGAGCTGCAGCTTGG - Intronic
1021921941 7:25494515-25494537 TGGTCTATTCAGCAGAAGCTTGG + Intergenic
1024577685 7:50778099-50778121 TGAAATAATCAGCACAAGAGGGG + Intronic
1028456247 7:91041041-91041063 TGACATAACGGGCAGAACCTGGG + Intronic
1032129091 7:129214350-129214372 TGAGATAATCAGTAGAAGACTGG + Intergenic
1034572852 7:151971006-151971028 TGTGATTATCAGTAGAAGCTTGG + Exonic
1037042232 8:14250458-14250480 TGTTATAATCAGCAGAATGTGGG + Intronic
1038569135 8:28644732-28644754 TGAAATAATCAGTTGAAGCAAGG - Intronic
1038570531 8:28658223-28658245 TGACATAATAAGCAGGAAGTTGG - Intronic
1038703238 8:29870913-29870935 TGACAGAACCAGCCCAAGCTAGG - Intergenic
1039574153 8:38610432-38610454 TGAGAAGATCAGCAGAAACTGGG - Intergenic
1039713682 8:40086026-40086048 TGACAGAGTCAGCAGTAGCAAGG + Intergenic
1040046256 8:42967055-42967077 TGAGATAATCAACAGAGGATAGG - Intronic
1043152443 8:76735106-76735128 TGACGAAATCAGCAGGACCTAGG + Intronic
1046446150 8:114322485-114322507 TGAAATAATTAGGAGAAGCCTGG + Intergenic
1046641346 8:116735192-116735214 AGACATAATCTGCAAAACCTAGG + Intronic
1046816115 8:118585713-118585735 TGTCCTAATCAGCAGAAGCAGGG + Intronic
1047221507 8:122922383-122922405 TTACAAAATCAGCAGATGTTAGG + Intronic
1047506826 8:125486701-125486723 TGATGTAATGAGCAGAAGCAGGG + Intergenic
1050112429 9:2230663-2230685 TTACATAATTAGCAGAAGGGAGG - Intergenic
1050205546 9:3192838-3192860 TGACATCATGTGCAGAAGCTTGG + Intergenic
1051428469 9:16958684-16958706 TGACATAATGAACACAATCTGGG + Intergenic
1051871074 9:21738261-21738283 TGACATTATTAATAGAAGCTAGG - Intergenic
1052097710 9:24404294-24404316 AGAAATAATAAGCAGAAGCTTGG - Intergenic
1055707286 9:79019512-79019534 TGAAATATTCTGCAGTAGCTTGG - Intergenic
1055708086 9:79030453-79030475 TGACATATACAGCATAAGCTGGG - Intergenic
1056337097 9:85582874-85582896 TGTCTTAATCACCAGAATCTAGG + Intronic
1061639625 9:131942118-131942140 TTAAAAAATCAGCAGAGGCTGGG - Intronic
1062307612 9:135918283-135918305 AGACACTGTCAGCAGAAGCTGGG + Intergenic
1187457691 X:19457314-19457336 TAACAACATCAGCAGAGGCTGGG + Intronic
1187590341 X:20710817-20710839 TGACTTAATCACTAGAAGCATGG + Intergenic
1189116720 X:38350527-38350549 TGACATAATCAGCAGAAGCTGGG + Intronic
1190792269 X:53711457-53711479 TGGCTTAAACAGCAGAAACTGGG - Intergenic
1193996366 X:88369712-88369734 TGACATAATCCGCAGAAAGAAGG - Intergenic