ID: 1189120971

View in Genome Browser
Species Human (GRCh38)
Location X:38394639-38394661
Sequence CATTAAAGGGAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189120971 Original CRISPR CATTAAAGGGAGGCCATGGA GGG (reversed) Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901412603 1:9094943-9094965 CATTAAAGGAATGACTTGGATGG - Intergenic
902139265 1:14338589-14338611 AATAAAAGAGAGGCGATGGAAGG + Intergenic
902866966 1:19286036-19286058 CAGGAAAGGGAGGCCAGGGTGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905777936 1:40682122-40682144 TATTAGAGGGAGGCCAGGCATGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906488343 1:46248257-46248279 AATTAAAGAGGGGGCATGGATGG - Exonic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908225877 1:62055650-62055672 CATTAAGGGGTAGCCATAGAAGG + Intronic
908284858 1:62585322-62585344 CATTAAAAGATGGACATGGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909643856 1:77895004-77895026 CACTATAGGCTGGCCATGGATGG - Intronic
910102806 1:83596833-83596855 CTAAACAGGGAGGCCATGGAAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913325930 1:117628915-117628937 CAAAGAAGGGAGGCCACGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917765479 1:178211874-178211896 AACTAAATGGAGGCCATTGAGGG + Intronic
917867778 1:179213680-179213702 CAATATAGGGAGGAAATGGATGG + Intronic
920226843 1:204445345-204445367 CATTTTTGGGAGGCCAAGGAGGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922510584 1:226163111-226163133 CATTAAAAGTAGGTCATGGCCGG - Intronic
922564421 1:226592292-226592314 CACTCATGGGAGGCCATGGCAGG - Intronic
923402245 1:233626308-233626330 GACCAAAGGAAGGCCATGGAAGG + Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064496301 10:15913978-15914000 AATTAAATGGAGGCCAGGCACGG - Intergenic
1064596699 10:16952916-16952938 GAGAAAAGGGAGGCCAGGGAGGG + Intronic
1066144692 10:32545503-32545525 AAGTATAGGGAGGTCATGGAAGG - Intronic
1067024832 10:42836039-42836061 AAGCAAAGGGAAGCCATGGAAGG - Intergenic
1068896127 10:62203752-62203774 CAATACAAGAAGGCCATGGAGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069315158 10:67089792-67089814 TAGTAAAGGAAGGCAATGGATGG - Intronic
1071793830 10:88984816-88984838 CAATAATGGGAGACCATGGGAGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1076082726 10:127598268-127598290 CATCTAAAGAAGGCCATGGAAGG - Intergenic
1076092509 10:127699972-127699994 CAGCAAAGGCATGCCATGGAGGG - Intergenic
1077114960 11:879964-879986 CATCAAAGGAGGGCCATGGTGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078529110 11:12122697-12122719 CATTAAAGGCAGGCCAGGCGCGG - Intronic
1083171955 11:60928507-60928529 CATGAAAGGGAGGCCCAGCATGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086694940 11:89832621-89832643 AAGTAAAGGCAGGCCATGCACGG + Intergenic
1086711208 11:90011875-90011897 AAGTAAAGGCAGGCCATGCACGG - Intergenic
1086894198 11:92293224-92293246 AATGAAGGGGAGGCCATGGAGGG + Intergenic
1086972562 11:93099305-93099327 CATTAGTGGGAGGTCATGGCTGG + Intergenic
1087028954 11:93682774-93682796 CATTATAGCTAGGGCATGGAGGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1089233873 11:117005985-117006007 CAGTAAAGGGAGGGAAGGGAAGG + Intronic
1089950830 11:122524627-122524649 CATTAAATGGAGGGAAGGGAAGG - Intergenic
1090410103 11:126502133-126502155 AATTAAGGGGAGGCCAGGGCAGG - Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091193888 11:133715914-133715936 CATGAAAAGGAGCACATGGAAGG - Intergenic
1091420018 12:329096-329118 AATAAAAGGGAGGACCTGGAGGG - Intronic
1092140356 12:6179362-6179384 AAGGAAAAGGAGGCCATGGAGGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092873381 12:12827045-12827067 CACTCAAGGGAGGCCAGGCATGG - Intronic
1093096942 12:14982489-14982511 CACTGAAGGGATGCCGTGGAAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098479952 12:70945873-70945895 CATTAATGGGATGCCACAGACGG + Intergenic
1099090654 12:78303432-78303454 CATGAAAGGGAGGGGATGAAAGG - Intergenic
1101874849 12:108591413-108591435 CACCACAGGGAGGCCAAGGAGGG + Exonic
1101906516 12:108830631-108830653 CAATAAAGGGAGGTCATGCTAGG + Intronic
1102585178 12:113917939-113917961 CATTAACTGGAGGCCATCGTAGG + Intronic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1103942575 12:124509034-124509056 CATGAAAGGCAGGCCAGGCAGGG + Intronic
1106575861 13:30974216-30974238 CAGGAAATGGAGGCCAGGGAGGG + Intronic
1108082385 13:46749970-46749992 CTTGAAAGGGAGGCTATTGAGGG + Intronic
1108744420 13:53377014-53377036 CAATCAAGGAAGGCCGTGGAGGG + Intergenic
1109982256 13:69924116-69924138 CATGGGAGGGAGGCCAAGGAGGG + Intronic
1110082515 13:71333807-71333829 CATTGAGGAGAGGCCATGTAAGG - Intergenic
1110777953 13:79432320-79432342 CATGGGAGGGAGGCCAAGGAGGG + Intergenic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1113221011 13:108102578-108102600 CAATAAAAGGAGGCCCTGGCAGG + Intergenic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1120166975 14:81211242-81211264 GATTAAAGGGAGGCAAGTGAGGG - Intronic
1122353392 14:101110275-101110297 CAGTAAGAGGAGGCCAGGGAAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123425465 15:20167491-20167513 AAGCAAAGGGATGCCATGGAAGG - Intergenic
1123534687 15:21174009-21174031 AAGCAAAGGGATGCCATGGAAGG - Intergenic
1125380229 15:39079468-39079490 CATTGAAGGGAGATCCTGGAAGG - Intergenic
1125403122 15:39325418-39325440 CAATTTAGGGAGGCCATGGCAGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127957291 15:63864311-63864333 CCCTAAAGGGAGGGCATAGAAGG - Intergenic
1133228251 16:4353526-4353548 AAATAAAGGGAGGCCAAGGTGGG - Intronic
1134182771 16:12061139-12061161 CATTCCAGGAAGGTCATGGAAGG - Intronic
1135764523 16:25166020-25166042 CACTTTAGGGAGGCCAAGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136858779 16:33682031-33682053 AAGCAAAGGGAAGCCATGGAAGG + Intergenic
1137246580 16:46710954-46710976 CATTAAAGGGAGGAAGCGGAAGG + Intronic
1137850524 16:51737527-51737549 CAATAAATGGAGGCCAGGCATGG - Intergenic
1138567036 16:57841180-57841202 AATTCAAAGGAGGACATGGAGGG + Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139972355 16:70784000-70784022 TATTCAAGGGAGAACATGGAGGG + Intronic
1141819878 16:86437972-86437994 CATTAAAAGGAGACCTTGGCTGG + Intergenic
1142326271 16:89416924-89416946 GATAAAAGGGGTGCCATGGAGGG - Intronic
1203120355 16_KI270728v1_random:1530524-1530546 AAGCAAAGGGAAGCCATGGAAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143148483 17:4791513-4791535 CATTATAGGGAGGGAAAGGATGG - Intergenic
1143893629 17:10120462-10120484 CAGTGAAGGGAGGCCAAGGCGGG + Intronic
1145233057 17:21189041-21189063 CACTAAGGGTAGGCCATGGTGGG - Intronic
1145245064 17:21263338-21263360 CAGTAAAGGCAGGCCAGGCATGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146673435 17:34757289-34757311 CTTGAAAGGGAGGTCAGGGATGG + Intergenic
1147150879 17:38512941-38512963 CATTAAAGGGAATCTAGGGAGGG + Intergenic
1147623308 17:41882767-41882789 GATGAAAGGGAGGCCAAGGAGGG - Intronic
1148166611 17:45488550-45488572 TATTAATGGGAGGACATTGAAGG + Intronic
1148747652 17:49927508-49927530 CACCTAAGGGAGGCCCTGGAGGG - Intergenic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1150397785 17:64834951-64834973 TATTAATGGGAGGACATTGAAGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1156994599 18:43450080-43450102 AATTAAAGGGAGGCCGAGGCGGG - Intergenic
1158260923 18:55604878-55604900 CACTGAAGGCAGGCCATTGAGGG + Intronic
1158851284 18:61497604-61497626 CATTATAGGAAGGCCATAAATGG - Intronic
1158883001 18:61799036-61799058 CACTAAAGAGAGGCCAGGAAGGG - Intergenic
1159035811 18:63276067-63276089 CATTAGAGGGAGGCCTCTGATGG + Intronic
1159059188 18:63496923-63496945 TCTTAAAGGGAGCCCATGGAAGG - Intronic
1160754031 19:748408-748430 CATTAAAGGGAGGCTGAGCAGGG + Intergenic
1162130539 19:8523452-8523474 CCTTAAAAGGAGGCTAAGGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164747776 19:30628673-30628695 AAATAAAGGGAGGCCAAGGTGGG - Intronic
1164828049 19:31298691-31298713 CATGACATGGAGCCCATGGACGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168092055 19:54092287-54092309 CTTTAAAGGGAGACCAAGGTGGG + Intergenic
925261146 2:2529674-2529696 CAAGAAGGGCAGGCCATGGAGGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926309711 2:11666745-11666767 TATTAAAGAGAGGCCAGGGGTGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928135758 2:28686325-28686347 CACTCAGGGGAGCCCATGGAGGG - Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928980979 2:37134912-37134934 CATTAAAGGAATGACGTGGATGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929803914 2:45128048-45128070 CATTCAGGGGAGGCGGTGGATGG - Intergenic
931545047 2:63373500-63373522 CATTTATGGGAGGCCAAGGCAGG - Intronic
932252255 2:70254733-70254755 CATTAAAAGGAAGCCAGGCACGG - Intergenic
934087671 2:88524054-88524076 CTTAAAAGGGAGGCCAGGCACGG - Intergenic
935320115 2:101878471-101878493 TATAAAATGGAGGCCATGGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935978535 2:108603729-108603751 GATTAAAAGGAGGCCAGGCATGG - Intronic
937632609 2:124120292-124120314 CAAAAAAGGAAGGCCATTGAGGG + Intronic
938032580 2:128008222-128008244 CATTACAGGGAGGTTAGGGAGGG - Intronic
938207569 2:129437339-129437361 CATTGAAGGAAGGGCCTGGAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941468334 2:165856115-165856137 CCTTAAAGGGAGGCCATGGGAGG + Intergenic
941597665 2:167497797-167497819 CCTTAGAGAGAGGCCATTGATGG + Intergenic
942326388 2:174780258-174780280 ATTTAAAGGGAGGTCAGGGAGGG - Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943499070 2:188664342-188664364 AATAGAAGGGATGCCATGGACGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945829395 2:214764662-214764684 CATTAAGAGGAAGCCACGGAAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947090962 2:226510982-226511004 CGTTAAAGGGAAGGGATGGAAGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948082059 2:235214565-235214587 CATTTAACAGAGGCCAGGGAAGG - Intergenic
948277734 2:236722741-236722763 CACAAAGGGGAGGCCATGCACGG - Intergenic
948474216 2:238206296-238206318 CATTAAAGGAATGACGTGGATGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169131792 20:3169586-3169608 CACTAAATGGAGGCCAAGCAAGG + Intronic
1170829800 20:19830361-19830383 CATGAAAGAGAGGCCAAGAAAGG - Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1171979855 20:31620024-31620046 CAGAAAAGGGAGGTCATGGCAGG - Intergenic
1172005031 20:31813339-31813361 GATTATAGGGAGGCCAAGGTGGG + Intergenic
1172715617 20:36961268-36961290 CACCAAAGAGAGGCCATGGGAGG + Intergenic
1173207649 20:41007301-41007323 CATGGAAGGGAGACCAAGGAAGG - Intergenic
1173426052 20:42944423-42944445 GATTAAAGGGAGGCCAGTGCAGG - Intronic
1173904403 20:46615418-46615440 TCTTACAGGGAGGCCAGGGAGGG + Intronic
1174323860 20:49763510-49763532 CACTAATGGGAGGCCAAGGCGGG - Intergenic
1175372264 20:58499896-58499918 GAACAAAGGGAGGCCAGGGACGG - Intronic
1175469701 20:59218764-59218786 CATTAAGAGGAGGCCAAGGAGGG + Intronic
1177154861 21:17491305-17491327 GATTAGAGGGAGGCCAAGTAAGG - Intergenic
1177768385 21:25485944-25485966 CATTAAAACGAGGGCATTGAGGG - Intergenic
1178750404 21:35297230-35297252 CATGAAAGGGACAACATGGATGG - Intronic
1178907464 21:36648528-36648550 CATAAAAAGGAGGCCAGGCATGG + Intergenic
1179186483 21:39089016-39089038 CATACAAGGAAGGCCAAGGATGG + Intergenic
1181368282 22:22396950-22396972 CAATTAAGAGAGGCCAGGGAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182012281 22:27010949-27010971 CTTTATTGGGAGGGCATGGAAGG - Intergenic
1182276924 22:29195665-29195687 CAGGAAAGGGAGGCCAGGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182590577 22:31376451-31376473 AATTAAAAGGAGGCCAGGAATGG - Intergenic
1183966264 22:41444782-41444804 CAGTAATGGGAGGCGATGAAGGG - Intronic
1183985699 22:41569018-41569040 CAGTGCTGGGAGGCCATGGAGGG - Intronic
1184162985 22:42709497-42709519 AATTAAATGGAGGCCAAGTACGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184617216 22:45646211-45646233 CATTGGAGGGAGGCCTTGGCAGG + Intergenic
1185373347 22:50470842-50470864 CTGGAAAGGCAGGCCATGGAGGG + Intronic
949195016 3:1294792-1294814 CATTATAGGGAGCCCAGAGAAGG - Intronic
949304696 3:2626893-2626915 CATCACAGGGATGCCATGCAAGG + Intronic
952271389 3:31835433-31835455 AATTAAAAGGAGGCAAGGGAGGG + Intronic
952782142 3:37111852-37111874 AATTAACGAGAGGCCCTGGAAGG - Intronic
952783229 3:37125393-37125415 CACTAATGGGAGGCCCAGGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956900700 3:73713072-73713094 TAATATAGGGAAGCCATGGAAGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961942960 3:130656535-130656557 GATTAATGGGAGGCCACTGACGG + Intronic
963077068 3:141356591-141356613 CAATCAAGGGAAGCCAGGGATGG + Intronic
963609923 3:147454000-147454022 CACTAAAGGGAGGGCACGGGTGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965169920 3:165249902-165249924 CAGAAAAGGCAGGCCATGGAAGG + Intergenic
965663824 3:171070187-171070209 CATAAAAGTGAGGTCATGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967734984 3:192942407-192942429 CAGTAAAGGGAAGCCATCCAAGG + Intergenic
968296094 3:197577578-197577600 CATTACAGGGAGGCCGGGGGAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969196850 4:5569875-5569897 CAGTGGAGGGAGGCCATGGATGG - Intronic
970146341 4:13040255-13040277 CTTTTAAAGGGGGCCATGGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972931947 4:44082844-44082866 CATTAAAATGAGGCCATAGTAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975932075 4:79537359-79537381 CATTCAGGGGAGGCCTTGGAAGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979352670 4:119663476-119663498 CTTTAAAGGGAGGGCATAGAAGG + Intergenic
980860042 4:138488040-138488062 CATTCAAGGCAGCCCATGTATGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984325150 4:178241862-178241884 CATGGAAGGGAGGCCAAGGAGGG + Intergenic
984683982 4:182645385-182645407 CATGAAAGGAAGGTCAAGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985188866 4:187349619-187349641 CATGAAATGGATGCCAGGGAAGG - Intergenic
986405416 5:7420237-7420259 CATTACAGAGAGGCCATGTTGGG - Intronic
986931774 5:12834038-12834060 CATTCAAGGGAGGCCGGGCATGG + Intergenic
989455274 5:41636963-41636985 CATTAACGGGAAGCCATGCAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990523297 5:56600626-56600648 CATAACAGGGAGGCACTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991717244 5:69462525-69462547 CATTTATGGGAGGCCAAGGCAGG + Intergenic
992487187 5:77208973-77208995 AAATAAAGGGAGGGAATGGAGGG - Intergenic
992642131 5:78777145-78777167 TATTAGAGGGAGGTCAAGGAAGG - Intergenic
993908589 5:93652281-93652303 CTTCAAAGGGAGGCCAATGATGG - Intronic
995118438 5:108508301-108508323 CATGACGGGGAGGCCAAGGAGGG + Intergenic
995362175 5:111309699-111309721 AGTTAAAGGGTGGTCATGGAGGG - Intronic
995520456 5:112999570-112999592 CACTAAGGGGAGGCCAAGGCAGG - Intronic
995796510 5:115946852-115946874 CAATTGAGGGAGGTCATGGAAGG - Intergenic
1001312431 5:170620936-170620958 CAGTAAAGGGAGGAGATGGAAGG - Intronic
1001705514 5:173738499-173738521 CAGTAAAGGGAGGTGTTGGAGGG - Intergenic
1002098826 5:176847363-176847385 CATAGAAGGGAGGCCCTGGAGGG - Intronic
1006359953 6:33581849-33581871 CACAAAAGGGAGGCCAAGGCAGG + Intergenic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008547989 6:52600184-52600206 CACTGAAGGAAGGCCAGGGAAGG + Intergenic
1008610166 6:53178223-53178245 AAGTCAAGGGAGGACATGGAGGG - Intergenic
1009724933 6:67526369-67526391 CATTCTAGAGAAGCCATGGAGGG + Intergenic
1010722299 6:79297136-79297158 CATGAAAGGGATGCAATGGGAGG - Intergenic
1015718686 6:136217993-136218015 CCTCCAAGGGAGGCCATGGCAGG + Intergenic
1017070121 6:150568624-150568646 CATTTTTGGGAGGCCATGGCTGG + Intergenic
1018397263 6:163387998-163388020 CATGAAGGGAAGGCCCTGGAAGG + Intergenic
1019173379 6:170147277-170147299 CTTTACAGTGAGGCCAAGGAAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019806371 7:3129230-3129252 CATAAAAGGGAGTTGATGGAGGG + Intergenic
1020202505 7:6091045-6091067 CAATCAAAGGAGGCCAAGGAAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022218204 7:28286242-28286264 CACAAAAGAGGGGCCATGGAAGG - Intergenic
1022388461 7:29923459-29923481 CACTCACGGGAGGCCACGGAGGG + Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027157066 7:75775953-75775975 CTTTATAAGAAGGCCATGGAGGG - Intronic
1027686243 7:81281616-81281638 AACTAAAGGGAGGGTATGGATGG - Intergenic
1027782757 7:82540177-82540199 GATTAAAGGGAATACATGGATGG - Intergenic
1028527452 7:91801530-91801552 CATGGGAGGGAGGCCAAGGAGGG - Intronic
1029190921 7:98771638-98771660 CATTACAAGGAGGCTCTGGAGGG - Intergenic
1029269114 7:99365904-99365926 CATTATCCGGAGGCCCTGGATGG - Exonic
1030810335 7:113964096-113964118 CCTTATAGGGAGTCCATGCATGG - Intronic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036154431 8:6328419-6328441 CACTAAAAGGAGGCCAGGCACGG - Intergenic
1036811310 8:11868826-11868848 TATTACCGGGAGGCCCTGGAAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041272917 8:56126160-56126182 AAGTAAAGGGAGGCCAGGCACGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045888005 8:107122832-107122854 CATGGAAGGGAGGCCAAGGCAGG + Intergenic
1046366620 8:113240155-113240177 CTTTGAAAGGAGGACATGGATGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047435430 8:124831829-124831851 CATTTATGGGAGGCCAAGGCGGG + Intergenic
1049811943 8:144579576-144579598 GATGAAAGGGAGGCCAGGGATGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051591508 9:18780317-18780339 CATTTACGGAAGGCCACGGAAGG + Intronic
1055061340 9:72072324-72072346 CAGTAAATGCAGCCCATGGAGGG + Intronic
1055162323 9:73145445-73145467 GACTTAAGGGAGGCAATGGATGG - Intergenic
1057465432 9:95310070-95310092 CAATAATGGGAGGCCAGGCATGG + Intronic
1058329129 9:103736994-103737016 AATTAAAGGGAGGCCAAGGCAGG + Intergenic
1059411014 9:114132400-114132422 CAGTGATGGGAGGCCCTGGATGG + Intergenic
1059834096 9:118130260-118130282 CATTAAAGTGAGGCCCTTAAGGG + Intergenic
1061569588 9:131468849-131468871 CATTAAAGGCGGTCCCTGGAAGG - Intronic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186459755 X:9739002-9739024 CACTGAAGGGAGGCCAAGGCAGG - Intronic
1187509046 X:19901171-19901193 AATAAAAGGGAGGCCAGGCACGG + Intergenic
1187970775 X:24655869-24655891 CATTAGGGGGAGGCCAAGGCAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic
1189614546 X:42769893-42769915 CATTAAAGGAATGACGTGGATGG - Intergenic
1189738823 X:44098161-44098183 CATTGAAGAAAGGCCATGTAAGG - Intergenic
1189760906 X:44320618-44320640 CATTGAAAGGAGGCCATGGAAGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190071897 X:47286525-47286547 CGTTAAAGGAATGACATGGATGG + Intergenic
1190155478 X:47988340-47988362 TGTTAAAGGGAGGGCATGGTGGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192668534 X:73114210-73114232 AATTACAGGGAGGGAATGGAAGG - Intergenic
1193401794 X:81054551-81054573 CATTGAAGGGAAGGCATTGAGGG + Intergenic
1197370259 X:125617700-125617722 CATAAAAGTGAAGCCCTGGAAGG - Intergenic
1197557226 X:127970562-127970584 CATTAACAGGAGGCCAGGTATGG - Intergenic
1197638474 X:128942399-128942421 CATTAAGAGGAGGTCATTGATGG + Intergenic
1200762812 Y:7055458-7055480 CATTAAAGTCAGGCCAGGGGAGG + Intronic