ID: 1189123201

View in Genome Browser
Species Human (GRCh38)
Location X:38417247-38417269
Sequence CTAAAGGCAATATAGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189123195_1189123201 20 Left 1189123195 X:38417204-38417226 CCTGACACATACTTTAAATATGG 0: 1
1: 0
2: 2
3: 14
4: 172
Right 1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG 0: 1
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189123201 Original CRISPR CTAAAGGCAATATAGGGAAT TGG Intronic
903518954 1:23933044-23933066 CAAAAGGCAACCTAGGGAATGGG + Intergenic
903820206 1:26096067-26096089 CTAAAGGAAATAGAGTGAAATGG - Intergenic
905131718 1:35765883-35765905 TTATAGGAAATAGAGGGAATAGG + Intronic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
909409893 1:75337953-75337975 CTAAAGGCAATGTGGAGAATTGG + Intronic
911277092 1:95875109-95875131 GTAAAGTCAATATATGTAATTGG - Intergenic
911491571 1:98575556-98575578 AGAAAGGCAATAGAGGGAAGGGG + Intergenic
911991888 1:104708573-104708595 GAAAAGGCAATCTAGGTAATGGG - Intergenic
912647500 1:111407852-111407874 CTAAATGCAATATAGGGTCATGG - Intergenic
912868351 1:113279940-113279962 CAAAAGGAATTAGAGGGAATGGG - Intergenic
912881098 1:113415118-113415140 CTAAAAACATTATAGGGAAGAGG - Intronic
914786655 1:150839124-150839146 CTAAAGGCAAGAAAGAAAATTGG + Intronic
915973453 1:160370057-160370079 GAAAAGGCAATCTATGGAATGGG - Intronic
916205021 1:162308147-162308169 CTAAAGGGCATCTTGGGAATGGG - Intronic
917902755 1:179559495-179559517 GCAAAGGCAATCTAGGGAATGGG - Intronic
918126683 1:181590081-181590103 CTAACTGCAACATAGGGAACTGG - Intronic
919151569 1:193707384-193707406 CTTAAGGCAAGATAGGCAAGGGG - Intergenic
920029113 1:203026194-203026216 CTAAGGCCAATTTAGGGAACGGG + Intergenic
920147703 1:203876537-203876559 AAAAAGGCAATCTATGGAATGGG - Intergenic
921066266 1:211624455-211624477 CTAAGGGCAATAAAGCAAATAGG + Intergenic
921616023 1:217268731-217268753 CTAAAGGCAATTTATGGACTGGG + Intergenic
922278752 1:224102504-224102526 ATGAAGGCAATAAAGGGAAGAGG + Intergenic
923889173 1:238192344-238192366 GAAAAGGCAATATAGTGTATGGG - Intergenic
924844582 1:247752786-247752808 ATACAGGAAATATAGGAAATAGG - Intergenic
1062776528 10:153834-153856 CTAAAGGTTACACAGGGAATGGG - Intronic
1064247353 10:13679704-13679726 CTAAAGACAAAAAAGGCAATGGG - Intronic
1064573627 10:16721755-16721777 CTAATGGCAATGTATGGAAATGG - Intronic
1068177726 10:53483852-53483874 CTAAATGCCATATAAGAAATTGG - Intergenic
1069058364 10:63867810-63867832 CTAAAGGCAAACTGGGGAAAGGG - Intergenic
1070082018 10:73198406-73198428 GAAAAGGCAATATGTGGAATGGG + Intronic
1073873352 10:107891601-107891623 GAAAAGGCAATCTATGGAATGGG - Intergenic
1074454641 10:113586648-113586670 ATAAAGGGACTATGGGGAATGGG - Intronic
1074699684 10:116082319-116082341 CCAAAGGCAATAAAAGGACTAGG - Intronic
1076944876 10:133639397-133639419 ATAAAGGCATTATATGGAATGGG + Intergenic
1077682259 11:4252985-4253007 AAAAAGGCAATCTATGGAATGGG - Intergenic
1077687781 11:4313757-4313779 AAAAAGGCAATCTATGGAATGGG + Intergenic
1077692943 11:4364941-4364963 AAAAAGGCAATCTATGGAATGGG + Intergenic
1079790753 11:24736121-24736143 CTAGAGGCAATCTAGGGAACAGG - Intronic
1085616594 11:78004648-78004670 CTAAAAGCAATGTAGGGCAAGGG - Intergenic
1086022502 11:82247852-82247874 CAAAAGTCAATCTATGGAATGGG + Intergenic
1086277617 11:85149909-85149931 TTAAAGGCAATATAGAGTAGTGG - Intronic
1086788445 11:91002970-91002992 ATAAAGGAAAAATAAGGAATTGG + Intergenic
1088416527 11:109595381-109595403 GGAAAGGCAATATAGAGAAAGGG - Intergenic
1089604120 11:119631815-119631837 CGAAAGGTAAAATAGAGAATTGG + Intronic
1090898027 11:130996933-130996955 CTCAAAGGACTATAGGGAATAGG - Intergenic
1093206170 12:16253337-16253359 GAAAAGGCAACATATGGAATGGG + Intronic
1093436997 12:19147490-19147512 CTAAAGGCAGTATGTGGTATAGG + Intronic
1100835602 12:98564238-98564260 CAAAAGACAATCTATGGAATGGG + Intergenic
1101228656 12:102715993-102716015 GCAAAGGCAATTTATGGAATGGG - Intergenic
1102278556 12:111600231-111600253 CTAAAGGAAATATATGGGATTGG + Intergenic
1102395606 12:112583368-112583390 CTCAAGGTCAGATAGGGAATAGG + Intronic
1103108314 12:118251088-118251110 CTAAAGGCTTTATAGGGAAAGGG + Intronic
1103189001 12:118984370-118984392 CTAGAGGCAATCTGGGGACTTGG + Intronic
1106710019 13:32320689-32320711 ACAAAGGGAATATAGGTAATGGG + Intronic
1107448393 13:40487839-40487861 GTAAAGGCAACTTAGGAAATGGG + Intergenic
1107847269 13:44529031-44529053 CTAAAGAGATTATAGAGAATTGG - Intronic
1109803841 13:67410898-67410920 CTAATGGCAAGATCGGGAGTAGG + Intergenic
1111080538 13:83301412-83301434 CTCAAGGAAATATAGGGAAGAGG - Intergenic
1112844314 13:103619105-103619127 CAAAAGGAAATATTGGGAAGAGG + Intergenic
1116283936 14:42947354-42947376 CTTAAAGCAATATAGAGAAATGG + Intergenic
1117863715 14:60122367-60122389 ATAAAGGCCAAAGAGGGAATAGG - Intronic
1118790172 14:69083949-69083971 CTGAAGGCAATAAAAGAAATGGG + Intronic
1202926393 14_KI270724v1_random:29866-29888 ATAAAGGCATTATAGGAAATGGG - Intergenic
1127234540 15:57034821-57034843 CTAAAGGCAGTATTGTGAAATGG - Intronic
1128474349 15:67984382-67984404 CTCAAGGGCATATAGGGAAAAGG + Intergenic
1128531687 15:68455285-68455307 GAAAAGGCAATCTATGGAATGGG + Intergenic
1129101196 15:73265723-73265745 CTAGTGGCAATCTAGGGAGTGGG + Intronic
1130433048 15:83868277-83868299 CTACAGTAAATATAGGGAAATGG + Intronic
1132990978 16:2793685-2793707 GAAAAGGCAACATATGGAATAGG - Intergenic
1133606690 16:7394428-7394450 CTAATGGCCATATGGGGAACAGG + Intronic
1135408557 16:22215982-22216004 CTGAAGGCAATACAAGGTATGGG + Intronic
1136017527 16:27411872-27411894 CAAAAGGCAACCTATGGAATGGG - Intronic
1137004186 16:35257207-35257229 ATAAAGGCAATATATGGGATGGG + Intergenic
1137020305 16:35418738-35418760 ATAAAGGCAATATATGGGATGGG + Intergenic
1137033423 16:35545967-35545989 ATAAAGACAATATATGGGATGGG + Intergenic
1137259725 16:46815452-46815474 GAAAAGGCAATACATGGAATGGG + Intronic
1138846187 16:60569485-60569507 AAAAAGGCAATCTATGGAATAGG + Intergenic
1143233212 17:5375264-5375286 CTAATGGCAAGATAGGCAACTGG - Intronic
1144061281 17:11584868-11584890 CTAAAGGGAAAATTGGGAGTGGG - Intergenic
1153896212 18:9563551-9563573 CTACAGGCAAAATAAGGAAATGG + Intronic
1154053526 18:10987748-10987770 GAAAAAGTAATATAGGGAATTGG + Intronic
1155242530 18:23877196-23877218 ATATAGTCAATATAGGGAACAGG - Intronic
1155441628 18:25868412-25868434 CTAACGGCAACACAGGAAATGGG - Intergenic
1156271705 18:35540867-35540889 GAAAAGGCAACATATGGAATTGG - Intergenic
1158121138 18:54049678-54049700 CTAAATGCAATATAGTGTACAGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1168381969 19:55931777-55931799 GCAAAGGCAAGAAAGGGAATCGG - Intronic
924994496 2:345342-345364 GAAAAGGCAATCTACGGAATGGG - Intergenic
927839036 2:26425845-26425867 AAGAAGGCAATATACGGAATAGG - Intronic
927984358 2:27397549-27397571 CTTAATGCAATATAGCGTATCGG + Intronic
928756972 2:34538260-34538282 CTACAGGTAACATAGTGAATGGG - Intergenic
931639344 2:64368191-64368213 CTGAAGAGAAGATAGGGAATTGG + Intergenic
932113678 2:69025092-69025114 CCAAAGGCAAGAGAGGGCATGGG - Intronic
932801029 2:74742622-74742644 TGAAAGGCTATATAGGGAGTTGG - Intergenic
933444420 2:82360570-82360592 GAAAAGGCAATCTATGGAATGGG - Intergenic
936797703 2:116226638-116226660 GAAAAGGCAATCTATGGAATGGG - Intergenic
936934078 2:117821217-117821239 CTGAAGGCAATAAAAGAAATGGG + Exonic
938129535 2:128700936-128700958 GTAAAGGCAACCTACGGAATGGG + Intergenic
939695286 2:145315873-145315895 GTAAAAGGAATATAGGGAATGGG + Intergenic
941159937 2:162024438-162024460 ATAAAGATAATGTAGGGAATGGG - Intronic
942177440 2:173347697-173347719 ATAAAGGCAATATAGCTAAAAGG - Intergenic
943057297 2:182998206-182998228 CCATAGCCAATATACGGAATGGG + Intronic
944534209 2:200693807-200693829 CAAAGGGCAATACTGGGAATGGG + Intergenic
944812227 2:203338841-203338863 GAAAAGGCAATTTATGGAATGGG + Intronic
945099180 2:206248718-206248740 ATAGAGGGAAGATAGGGAATTGG + Intergenic
1170201081 20:13744816-13744838 CTAAAGCCTACATGGGGAATAGG - Intronic
1170312092 20:15003596-15003618 GGAAAGGCAAGATAGGGAGTGGG - Intronic
1171782204 20:29429375-29429397 GTAAAGGCATTATAGGAAATGGG + Intergenic
1176687443 21:9863263-9863285 CAAAAGGCAAGAGAGAGAATGGG - Intergenic
953693039 3:45135859-45135881 TGAAAGGCAACATAGGGAAGAGG + Intronic
955096867 3:55807390-55807412 CTGAATGCAAAATAGGGAAGTGG + Intronic
956746584 3:72315632-72315654 ATAAAGCCAATGTAGTGAATTGG - Intergenic
957083280 3:75657014-75657036 ATAAAGGCATTATATGGAATGGG - Intergenic
957872852 3:86110522-86110544 ATAAAGGCAGTATAGTAAATTGG - Intergenic
959513865 3:107244144-107244166 CTAATGGCAAAATAGGTTATGGG - Intergenic
960655455 3:119998876-119998898 CTAAAGGCTACACAGGAAATGGG + Intronic
962437483 3:135380371-135380393 CTGAAGGCAAGACAGGGAAAAGG - Intergenic
963010580 3:140766428-140766450 CTCAATGCATTATAGGGAAAGGG + Intergenic
964542426 3:157794222-157794244 TAAAAGGCAATATAGAGTATTGG + Intergenic
965822125 3:172694906-172694928 GTAAAGGAAATATAGGAAATAGG - Intronic
966707229 3:182929712-182929734 TGAAAGGCAATCTATGGAATAGG + Intergenic
967852773 3:194094649-194094671 CTAAAGGCAAAATAGGCACTGGG - Intergenic
968336687 3:197919559-197919581 CTGAAGGCAATTTTGGGATTTGG - Intronic
970817516 4:20175294-20175316 CTAGAGGCAATGTAGGCAACTGG + Intergenic
976131787 4:81892253-81892275 TTAAAAGCAACAGAGGGAATAGG - Intronic
977725957 4:100297188-100297210 CTAACAGCAATATATGTAATGGG - Intergenic
979131065 4:117045287-117045309 GAAAAGGCAACATATGGAATTGG - Intergenic
980308049 4:131090330-131090352 AAAAAGGCAGTATAGTGAATGGG + Intergenic
980809522 4:137857326-137857348 CTAAGGGAAGTTTAGGGAATAGG - Intergenic
981235839 4:142414965-142414987 CTAAAAGCAATATTGTGAGTCGG + Intronic
981454950 4:144942489-144942511 CTCATGGCAATACAAGGAATCGG + Intergenic
981836475 4:149060396-149060418 GAAAAGGCAATCTATGGAATGGG - Intergenic
981967475 4:150622635-150622657 CTAAAGGCAACAGATGGAAACGG + Intronic
982883809 4:160752344-160752366 AGAAAGGCAATCTAGCGAATGGG - Intergenic
982907537 4:161094330-161094352 CTAAAAGCAATAAAGGTAAGGGG + Intergenic
985448260 4:190039909-190039931 ATAAAGGCATTATATGGAATGGG + Intergenic
987184953 5:15407774-15407796 CTGAAGGCAGTATATGTAATAGG - Intergenic
988355858 5:30173196-30173218 ATAAGGGGAATATAGGCAATAGG + Intergenic
988927142 5:36001107-36001129 CAAAAGACAATATATAGAATTGG + Intergenic
990049382 5:51477941-51477963 CTAAAGACAGTATAGGGGAAGGG + Intergenic
992595302 5:78340636-78340658 CTAAAGGCAAAAAAGAGAAATGG + Intergenic
992758198 5:79929066-79929088 CTAAAGGAAATCTGGGGAAAAGG - Intergenic
992781304 5:80130658-80130680 CTAAACTCTATTTAGGGAATGGG - Intronic
994744627 5:103663547-103663569 CGATAGGCAATATAGGTATTTGG - Intergenic
995672381 5:114621247-114621269 GTACAGGAAATATAGGGATTTGG - Intergenic
996751883 5:126896984-126897006 CTCAAGGCAGTTTAGGGAAATGG - Intronic
997181047 5:131829553-131829575 AGAGAGGCAATATAGGCAATCGG + Intronic
997769347 5:136540802-136540824 CTAAAGCAAAAATAGGCAATTGG - Intergenic
998799616 5:145856206-145856228 AGAGAGGAAATATAGGGAATTGG + Intergenic
999256436 5:150212218-150212240 CTAAAGTCAATACAGGGATCAGG - Intronic
1002654076 5:180728535-180728557 CTAAAGCCAATATGAGAAATAGG + Intergenic
1003720654 6:8697999-8698021 AAAAAGGCAATCTATGGAATTGG - Intergenic
1004576264 6:16898131-16898153 AGAAATGCATTATAGGGAATTGG - Intergenic
1004731590 6:18364831-18364853 CTGAAGGCAATAAAAGAAATGGG - Intergenic
1005511690 6:26517733-26517755 CTAAAGGCAGTGTAGGGAGAGGG - Intergenic
1005598878 6:27406471-27406493 CCAAAGGCCATATATGGACTTGG - Intergenic
1005696368 6:28356116-28356138 CCAAAGGCAATATGTGGACTCGG - Exonic
1006664034 6:35676632-35676654 CTACAGATAATATAGGGATTTGG - Intronic
1008095608 6:47336511-47336533 ATAAAGGCAAAATAGGAAAGTGG - Intergenic
1008155545 6:48009401-48009423 CAAAAGGAAATGTTGGGAATCGG - Intronic
1008201113 6:48592036-48592058 CAAAAGCCAAAATAGGCAATGGG - Intergenic
1010418377 6:75642413-75642435 CTAAAGACTAAATGGGGAATTGG + Intronic
1011376051 6:86687967-86687989 CTCAAGTCTATAGAGGGAATGGG - Intergenic
1011759927 6:90552468-90552490 TTAAAGGCAGTATAGGAAACTGG + Intronic
1012847171 6:104405155-104405177 GAAAAGGCAATACATGGAATGGG + Intergenic
1013645200 6:112131187-112131209 TTAAAGGCAATATAGTGTGTAGG + Intronic
1014261183 6:119219307-119219329 CTAAAGGTAAATTAGGGAATGGG + Intronic
1014560058 6:122879109-122879131 CCTAAGGCAAAATATGGAATTGG + Intergenic
1015469248 6:133585167-133585189 ATAAAGGCCATAAAGGGAATTGG - Intergenic
1016294198 6:142556608-142556630 CTAAAGCAAATATAGGCAAATGG + Intergenic
1016601057 6:145861183-145861205 GAAAAGGCAACCTAGGGAATGGG + Intergenic
1017339168 6:153300609-153300631 CTAAATGCAATGCAGGGAAGGGG - Intergenic
1018004461 6:159608594-159608616 CCAAAGGTAGTATAGGGAACAGG + Intergenic
1021076351 7:16308782-16308804 CTAAAAGCAAAACAGGGAATAGG + Intronic
1023707362 7:42954983-42955005 CTAATGGCAATGTAGGGTCTGGG + Intergenic
1026471588 7:70697568-70697590 AAAAAGGAAATATAGGAAATGGG - Intronic
1027182027 7:75947675-75947697 CTCAAGGGAATGAAGGGAATCGG - Intronic
1027449361 7:78312435-78312457 CAACAGGCAATATATAGAATGGG + Intronic
1028090551 7:86695417-86695439 GTAACACCAATATAGGGAATAGG + Intronic
1028990469 7:97044084-97044106 CCAAAGGCAATAAAGGAGATGGG - Intergenic
1029048201 7:97654045-97654067 ATCAAGGCAAAATAGGTAATTGG - Intergenic
1030340344 7:108372411-108372433 TTAAAGGCAACCTATGGAATAGG + Intronic
1031704320 7:124962205-124962227 ATGAAGGAAATATAGGGAAATGG + Intergenic
1031780867 7:125962629-125962651 GAAAAGGCAATTTATGGAATGGG + Intergenic
1032686199 7:134236285-134236307 CAAAAAGGAATATAAGGAATTGG - Intronic
1032773502 7:135085360-135085382 CTAAAGCAAATATAGGCAAATGG - Intronic
1032973280 7:137190492-137190514 ATAAAAGAAATATAGGGTATTGG - Intergenic
1033308587 7:140242415-140242437 CTAAAGTCAATGTAGAGAAGGGG + Intergenic
1033591719 7:142813940-142813962 CTAAATGCAATATGAGTAATAGG + Intergenic
1033757236 7:144405035-144405057 CTCAAGGCAATTAAAGGAATAGG - Intronic
1035916886 8:3634528-3634550 TTAAAGGCAAAAAAGGGAAGAGG - Intronic
1036112418 8:5918255-5918277 GGAAAGGCAGGATAGGGAATGGG - Intergenic
1037409582 8:18582323-18582345 GAAAAGGTAAGATAGGGAATTGG - Intronic
1041284080 8:56242574-56242596 CCAAAGGCAATGTAGTGATTGGG - Intergenic
1041845788 8:62327252-62327274 ATAAAGGCAATCCACGGAATGGG - Intronic
1044584920 8:93860327-93860349 GTCAAGGGAATACAGGGAATGGG - Intronic
1046230305 8:111347310-111347332 CTATAGGTAAAACAGGGAATGGG - Intergenic
1048423633 8:134302317-134302339 CAAAAGGAAGTATTGGGAATGGG + Intergenic
1050833166 9:10039964-10039986 CTAAAGGCAATTTAGGAGAATGG - Intronic
1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG + Intronic
1051492986 9:17687798-17687820 CTCAAGGCAGTATGGGGAAAGGG + Intronic
1052562187 9:30099805-30099827 GAAAAGGCAATCTAGAGAATGGG + Intergenic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1055178234 9:73348133-73348155 CTAAAAGCCATATAGGCAAGAGG - Intergenic
1056750006 9:89342696-89342718 CTAAAAGAAATATCTGGAATAGG + Intronic
1057242621 9:93425105-93425127 GAAAAGGCAATCTATGGAATGGG - Intergenic
1058227743 9:102386761-102386783 CTTAAAGCAATTTAGTGAATTGG - Intergenic
1203442009 Un_GL000219v1:17625-17647 ATAAAGGCATTATATGAAATGGG + Intergenic
1203512817 Un_KI270741v1:136534-136556 ATAAAGGCATTATATGAAATGGG + Intergenic
1186229252 X:7435530-7435552 CCAAAGTCAATATATGGAAATGG + Intergenic
1186501775 X:10056586-10056608 CTAAAGGAAATATCCAGAATAGG - Intronic
1187884013 X:23871977-23871999 CTAAAGGCAAAATAAGTAACAGG - Intronic
1188655574 X:32691033-32691055 GAAAAGGCAATCTATGGAATGGG + Intronic
1188825417 X:34826870-34826892 CAAAAGGCAAGTTATGGAATAGG + Intergenic
1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG + Intronic
1189485637 X:41429274-41429296 ATAAAGGAAATATAGGAAAGTGG - Intergenic
1189606270 X:42681637-42681659 CTAATGGCAATAGACGGAGTGGG + Intergenic
1190228405 X:48563014-48563036 CCCAAGGCAATATAGGGGAGAGG - Intergenic
1192789580 X:74368221-74368243 CTGAATGCAATAGAGGCAATCGG - Intergenic
1192926881 X:75763844-75763866 CCACAGGCAATATACTGAATGGG + Intergenic
1194087857 X:89551317-89551339 CTAAATGCAATAAGGGAAATTGG + Intergenic
1194242908 X:91473750-91473772 CAAAAGACAATCTATGGAATGGG + Intergenic
1194626525 X:96232377-96232399 CTAAATGCAATGGAAGGAATTGG + Intergenic
1196476770 X:116096199-116096221 CAAAAGGCAATCTATGGAATGGG - Intergenic
1196657253 X:118231607-118231629 TGAAAGGCAAGATAGGGTATAGG - Intergenic
1200969262 Y:9133055-9133077 CTAAAGGCAGTAGAGAGATTTGG + Intergenic
1201198061 Y:11513645-11513667 GTAAAGGAAATATATGGAATGGG + Intergenic
1201522310 Y:14888779-14888801 CAACAGGCAATCTAGAGAATGGG - Intergenic
1201741565 Y:17329568-17329590 CTAAATGCAAGATAAGGAAAAGG + Intergenic
1202141562 Y:21729434-21729456 CTAAAGGCAGTAGAGAGATTTGG - Intergenic
1202145303 Y:21774368-21774390 CTAAAGGCAGTAGAGAGATTTGG + Intergenic
1202196526 Y:22304077-22304099 CTAAATACAATATTGTGAATAGG - Intergenic