ID: 1189124311

View in Genome Browser
Species Human (GRCh38)
Location X:38429764-38429786
Sequence TGAGAATAATTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 437}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189124303_1189124311 27 Left 1189124303 X:38429714-38429736 CCCAGAGCAAGCCTCTCAAAGAA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG 0: 1
1: 0
2: 2
3: 54
4: 437
1189124306_1189124311 16 Left 1189124306 X:38429725-38429747 CCTCTCAAAGAAGGTGACCTTAA 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG 0: 1
1: 0
2: 2
3: 54
4: 437
1189124307_1189124311 -1 Left 1189124307 X:38429742-38429764 CCTTAAACTGAGTCCTGACTGAT 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG 0: 1
1: 0
2: 2
3: 54
4: 437
1189124304_1189124311 26 Left 1189124304 X:38429715-38429737 CCAGAGCAAGCCTCTCAAAGAAG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG 0: 1
1: 0
2: 2
3: 54
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189124311 Original CRISPR TGAGAATAATTGGGAAAAAC AGG Intronic
900713610 1:4130201-4130223 AGGGAATAATTTGGAAGAACAGG - Intergenic
901710353 1:11109435-11109457 AGTGAATATTTGAGAAAAACAGG - Intronic
902862051 1:19253535-19253557 TGAGAATAGTTGGGGAAGACAGG + Intronic
903944515 1:26953272-26953294 TGGCAATAATGTGGAAAAACTGG + Intronic
904596770 1:31651666-31651688 TTAGAATAATAAAGAAAAACAGG + Intergenic
905263166 1:36733297-36733319 TGAAAATAATAGGAAAAAAATGG + Intergenic
906757981 1:48339169-48339191 GGTTAATAATTTGGAAAAACTGG + Intronic
906999397 1:50834441-50834463 TCAGAGTCATTGGGAAAGACAGG + Intronic
907449624 1:54536312-54536334 TGAACAGAAGTGGGAAAAACAGG - Intergenic
907538807 1:55193001-55193023 TGAAAATATTTGGGAAAAAATGG + Intronic
907832543 1:58078810-58078832 TGACAATAATATGAAAAAACAGG + Intronic
908399852 1:63761170-63761192 TGACAAGAATTGGGAGAAACTGG - Intergenic
908476698 1:64495827-64495849 TGGGAAGAAATGGGAAAAGCAGG - Intronic
908783231 1:67710904-67710926 TGAGAATAAATGGGTAGGACAGG + Intronic
908860357 1:68479403-68479425 TGTGAAGTATTGGGAAAAAGTGG + Intronic
909250864 1:73354316-73354338 TGAGAATCATTTTGAAATACAGG + Intergenic
909590361 1:77341823-77341845 TGAAAAGATTTGGGAAAATCAGG + Intronic
910856023 1:91696696-91696718 TGAATATAAGTGGGAAATACAGG + Intronic
910984181 1:92989564-92989586 TGAGCAAAATTGGAAAAAAATGG + Intergenic
911687634 1:100795262-100795284 TGATCATAATTGGCAATAACTGG + Intergenic
912196120 1:107399178-107399200 TGAGAAACATTGGGTAAAATAGG - Intronic
914216681 1:145637058-145637080 TGAGAAAAATAGGCAGAAACTGG + Intronic
915577479 1:156789528-156789550 TGAGGAGTATTGAGAAAAACAGG + Intronic
915915046 1:159935903-159935925 TGAGACTAATTGGGGAAACAGGG - Intronic
917106776 1:171500103-171500125 TGAGAATAATGAGGAAAGAACGG + Intronic
917544239 1:175946491-175946513 AGAGAATATGTGGAAAAAACAGG + Intronic
917859094 1:179128488-179128510 TGAAAAGAATTGGTAATAACAGG + Intronic
918251273 1:182705748-182705770 TGAGAAGAATTGGAAGGAACTGG - Intergenic
918771439 1:188565821-188565843 TGAGAATAACTGGAAAATAATGG + Intergenic
919485585 1:198143173-198143195 AGAGAATAATGGAGAAAAATAGG + Intergenic
919875781 1:201866665-201866687 TGAGATTGATTGGGAAAACCAGG + Intronic
919961902 1:202479309-202479331 TGAGAATAACTAGAAAAAACTGG + Intronic
920714949 1:208331481-208331503 TGAGAATCATTTGGAACAGCAGG - Intergenic
920976417 1:210790080-210790102 TGAAAAGAATTGGGAAAGCCAGG - Intronic
921165555 1:212504328-212504350 TGAGAATAACTGGGAACTAGTGG - Intergenic
921670696 1:217920853-217920875 TGAGAAGAATGGGGAAAATGTGG - Intergenic
921839744 1:219815751-219815773 TGAGAATGAATGGGAGACACAGG - Intronic
922067701 1:222159761-222159783 TGAGAATAATGCAGAATAACTGG - Intergenic
922867615 1:228873586-228873608 TGTGAAGAATTAGGAAAAAATGG - Intergenic
923135561 1:231115329-231115351 TGAGGAGAATTAAGAAAAACTGG + Intergenic
923653313 1:235893916-235893938 TGAAAATCATTGCGAAAAATTGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
924857395 1:247887638-247887660 TCAAGATAATTGGGAAAAAAAGG + Intergenic
924870309 1:248035647-248035669 GGACAAAAATAGGGAAAAACTGG - Intronic
1064334118 10:14423113-14423135 TGTGAATATCTGGGAAAAATAGG - Intronic
1065662909 10:28024652-28024674 TGAGAAAAGCTGGGAAAAGCTGG - Intergenic
1066790715 10:39059850-39059872 TGAGGACTATGGGGAAAAACTGG + Intergenic
1068177656 10:53482602-53482624 TGAGAATACTTTGTAAAAACTGG - Intergenic
1068233659 10:54203797-54203819 TGAGGATGATTCTGAAAAACGGG + Intronic
1068327163 10:55507650-55507672 ATAGCATAATTGGGAAAAACTGG + Intronic
1068958115 10:62839215-62839237 TGAGAATAAGAGGGAAAGAGAGG + Intronic
1070368568 10:75759953-75759975 TGAGTATAACTTGTAAAAACTGG - Intronic
1071117397 10:82237399-82237421 TAAGAATAAGCAGGAAAAACAGG - Intronic
1073901559 10:108228236-108228258 TGAGAATGAGTTGGAAAAATAGG + Intergenic
1077941041 11:6843870-6843892 TGAGGATTATTGGGAACAAAAGG - Intergenic
1078092337 11:8272469-8272491 TGAAAATAAATGTGAAAACCTGG + Intergenic
1078128294 11:8590232-8590254 TGATGATTATTTGGAAAAACTGG - Intronic
1078950748 11:16131223-16131245 TCAGAATAATTAAGAAAAACTGG + Intronic
1079229246 11:18635163-18635185 TGAAAATAATTAGGCAAACCTGG + Intergenic
1079640955 11:22804814-22804836 TGAGAATAATAGATAAAAATGGG + Intronic
1079949808 11:26786571-26786593 GGAGAGTAATTTGGAAAGACTGG - Intergenic
1079976587 11:27099335-27099357 TAAGAATAATGGGGTAAAACTGG + Intronic
1080133424 11:28823890-28823912 TTAGAAAAATTGGAAAATACTGG + Intergenic
1080320421 11:31002889-31002911 TGTTAATAATTGTGTAAAACTGG - Intronic
1080616754 11:33951165-33951187 TCAGAATAGTTGGGTAGAACTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081004390 11:37716757-37716779 TGAGAATACCAAGGAAAAACTGG - Intergenic
1081930896 11:46870347-46870369 TGACAATATTTGGCAAAAAAGGG + Intronic
1082687376 11:56257573-56257595 TGAGAGTTATTGGGAAAAGCAGG + Intergenic
1082815345 11:57504347-57504369 TGCTAATAATTGGGTAAAGCAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083126576 11:60573754-60573776 TGAAAAATATTGAGAAAAACTGG - Intergenic
1083400013 11:62417023-62417045 AGAGAAGACTTGGGAAAAATAGG - Intronic
1083798621 11:65033212-65033234 TGAGAATATTTGGGATATATTGG + Intronic
1084684320 11:70684918-70684940 TGAGGATAATTTGGGAAAAGAGG + Intronic
1085656430 11:78319360-78319382 TGAGAATTATTGGGCACAAAGGG - Intronic
1086333257 11:85775173-85775195 AGAGAATAATTAGGAAAATAGGG + Intronic
1086427968 11:86705524-86705546 TCAGAACAATTTAGAAAAACTGG + Intergenic
1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG + Intergenic
1086549196 11:88034482-88034504 TGACAAGAATTCAGAAAAACTGG - Intergenic
1086609204 11:88733866-88733888 AGAGAAAAATAGGGAAAAAGAGG + Intronic
1087056937 11:93946019-93946041 AGAGAATAATGGGATAAAACAGG - Intergenic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1088673836 11:112171091-112171113 TGAAAATATTTGGAAAAAAAGGG + Intronic
1089985571 11:122809773-122809795 TGTGAAGAATTAGGAGAAACTGG + Exonic
1090509529 11:127359991-127360013 GGAAAAAAATTGGGAAAAATGGG - Intergenic
1091784889 12:3237393-3237415 GGAGAATAGGTGGGAAATACAGG - Intronic
1092488503 12:8923530-8923552 TGAAAATATTTGGGAAAGGCCGG + Intronic
1092780404 12:11981160-11981182 AGAAAGTAATTGTGAAAAACTGG - Intergenic
1093734685 12:22607229-22607251 TGAAAATACTTAAGAAAAACAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094545434 12:31400117-31400139 TAAGAATAATTTCTAAAAACAGG + Intronic
1095265587 12:40153430-40153452 TGAGAATCATCTGGAACAACAGG - Intergenic
1097180081 12:57166854-57166876 AGAGAATAATAGGGAAGAAGAGG + Intronic
1097347618 12:58511685-58511707 TGAGCATAAATGAGAGAAACTGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1098636403 12:72789550-72789572 TGAGAATAAATTGTAAACACTGG + Intergenic
1099115997 12:78624777-78624799 TTAGAATAATGGGAAAAAGCAGG - Intergenic
1099578553 12:84410855-84410877 TGAGAATTATTGGGAAGTATTGG + Intergenic
1102339304 12:112109079-112109101 GGAGAATAAATAGGATAAACAGG - Intergenic
1103092765 12:118109143-118109165 TAAAAATAATTAGGATAAACTGG + Intronic
1103617672 12:122165049-122165071 TGAGAATCTGTGGGGAAAACAGG + Intergenic
1105392140 13:19990022-19990044 TGGGAACAAGAGGGAAAAACTGG - Intronic
1106438324 13:29743166-29743188 TAAGAATAGTTGGGACAAATGGG + Intergenic
1107070542 13:36263549-36263571 AGAGAATAATTAGGTGAAACAGG + Intronic
1107192731 13:37608873-37608895 AGAAAATAATTTAGAAAAACTGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107455905 13:40554271-40554293 AGAAAATTATTGGGAAAAAGCGG - Intergenic
1107750754 13:43563631-43563653 CTAGATTAATTGAGAAAAACAGG + Intronic
1108948074 13:56047817-56047839 TCAGAATACTTGGCAAAAATAGG + Intergenic
1111983706 13:95043636-95043658 TGAACATAATTGGGAGCAACAGG + Intronic
1112040382 13:95541311-95541333 TGAGCATAATTAGGAGAAACTGG + Intronic
1112841772 13:103588162-103588184 TGAGAGTAATTAGAAATAACCGG + Intergenic
1113150911 13:107262697-107262719 TGATAATATTGGGGAAAAAATGG - Intronic
1113181531 13:107633820-107633842 TGAGACCAATTTGGTAAAACAGG - Intronic
1113369662 13:109711826-109711848 TGAGAATAAATGGAAGATACTGG + Intergenic
1113396936 13:109956534-109956556 TGAGGACACTGGGGAAAAACTGG - Intergenic
1114914564 14:27246829-27246851 TGAGAATAATTGGAATAAAAAGG + Intergenic
1115057419 14:29146956-29146978 TGTAAATAATTTGTAAAAACTGG + Intergenic
1116153248 14:41169048-41169070 TATGAATCATTAGGAAAAACAGG - Intergenic
1116204032 14:41837886-41837908 TGAGTATATTTGTGAAAAATTGG - Intronic
1116461830 14:45185828-45185850 TGAGAAAAATTTGGAGTAACTGG + Intronic
1116663667 14:47746964-47746986 TAACAATAAATGGAAAAAACTGG + Intergenic
1117914869 14:60666945-60666967 CGCGAATAATTGGGAAAATGCGG + Intergenic
1118040352 14:61909630-61909652 TGAGCTTACTTGGGAAAAAGGGG - Intergenic
1118041426 14:61921216-61921238 TGACAATAATTAAGCAAAACAGG - Intergenic
1118299827 14:64605454-64605476 TGAGAAGTAGTGGGAAAAAATGG - Intergenic
1118436680 14:65777492-65777514 TGAAAATGATTTGGAAAAATTGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119568754 14:75651219-75651241 TGAAAATAAAAGGGAAAAAGGGG + Exonic
1120199626 14:81522926-81522948 TGAAAATATTTGGAAAAAATGGG - Intronic
1120801080 14:88689521-88689543 TGAGTCCAATTGGGAAAAATGGG - Intronic
1123186411 14:106521454-106521476 AGGGAACAACTGGGAAAAACAGG + Intergenic
1123714654 15:23018455-23018477 TGAGAATTTTTGTGAAAAATAGG - Intronic
1123825976 15:24082515-24082537 TTTGAAGAATTTGGAAAAACAGG - Intergenic
1124368498 15:29090376-29090398 TGAGTAGATTTGGGAAAGACTGG - Intronic
1125132437 15:36299344-36299366 TGAGGCTAAGTGGGTAAAACTGG - Intergenic
1125191496 15:36999067-36999089 TGAAAATAATTGCGTATAACTGG + Intronic
1125950575 15:43748048-43748070 TGTCAATAATTTGTAAAAACTGG + Intronic
1126637628 15:50794665-50794687 TGAAAATATTTGGGAAAAAAAGG + Intergenic
1126797151 15:52268737-52268759 CGAGAAGGATTGGGAACAACTGG + Intronic
1127546471 15:59997944-59997966 TTCCAATAAGTGGGAAAAACGGG - Intergenic
1130004530 15:80082204-80082226 TGCAAATAAGTGGTAAAAACAGG + Intronic
1131785826 15:95910439-95910461 TGAAAATAAAAGGGAAAAACTGG - Intergenic
1137908828 16:52354564-52354586 TGGGAACAATTGGGAAATATAGG + Intergenic
1138058160 16:53857926-53857948 TGAAAATAATTGTTAAAAACTGG - Intronic
1138070275 16:53986018-53986040 TGAGCAAAATTCTGAAAAACTGG + Intronic
1138074090 16:54023761-54023783 TGAAAATAATAGAGAAAAATGGG + Intronic
1139209103 16:65058679-65058701 TGTAAAAAATTGGGAGAAACAGG + Intronic
1139935212 16:70565488-70565510 TGTGAACAATGGGGAAAAACTGG + Exonic
1143313045 17:6009340-6009362 TATGCATAATTGTGAAAAACTGG - Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1145764082 17:27446056-27446078 TGAGAATAAAAGGGATAAAATGG - Intergenic
1145930380 17:28681118-28681140 TAATAATAATTGGAAAAAACTGG + Intronic
1147272756 17:39287850-39287872 TGACAAGGATTTGGAAAAACTGG - Intronic
1147352980 17:39866718-39866740 TGTCAATAATAGGGAAAATCGGG + Intergenic
1147519527 17:41156992-41157014 TGAGGATTATTGGGAAAAAAAGG + Intergenic
1148868203 17:50640164-50640186 TGAGAATAATTGCAAAAAGCAGG + Intronic
1150925658 17:69529102-69529124 TGAGAATCATTGGATTAAACTGG - Intronic
1151206309 17:72510320-72510342 TTAGGATAACTGGGAAAAAAAGG + Intergenic
1153275184 18:3360884-3360906 TGAGAAAAGATGGGAAATACCGG - Intergenic
1153516846 18:5911719-5911741 TTAGAATTATGGGGTAAAACCGG - Intergenic
1153692575 18:7608199-7608221 TGAGATGACTTGGGAAAAAGAGG + Intronic
1153831245 18:8925202-8925224 TGAGATTAGTTTGAAAAAACTGG + Intergenic
1155688046 18:28579834-28579856 AGAAAATAAATGAGAAAAACAGG - Intergenic
1155707059 18:28828992-28829014 TGAAAATGAGTGTGAAAAACTGG - Intergenic
1155886075 18:31210071-31210093 TGTGCATAATTGTTAAAAACTGG - Intergenic
1156147633 18:34204798-34204820 TGAGAATAATGGAGAAAAAAAGG + Intronic
1157038777 18:44011801-44011823 ACAGAATAATTTGAAAAAACTGG - Intergenic
1157109185 18:44803715-44803737 TGAGAAAAATAGTGAAAAAGAGG - Intronic
1157172616 18:45421995-45422017 TGAGAATGAGTGGGAAAGATAGG + Intronic
1157844879 18:50993923-50993945 TGAAAATAACTGGGAAACATTGG - Intronic
1158374297 18:56846374-56846396 TGAGGATAGTAGGGAAAGACTGG - Intronic
1162185089 19:8898549-8898571 TGAGAATAATTGGGACAGCTAGG + Intronic
1162876241 19:13623018-13623040 TCTCAATAAGTGGGAAAAACTGG - Intronic
1163947617 19:20554353-20554375 CCAGAAAAACTGGGAAAAACAGG - Intronic
1164120481 19:22261557-22261579 TGGGAATAATTGGTCAAAAGTGG - Intergenic
1165379121 19:35465420-35465442 AGAGAAAAAATGGGAAAAAAGGG - Intergenic
1165728252 19:38127271-38127293 TCAAAATAATTGGGAAAGAGAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166942975 19:46378579-46378601 TGAGAATTATAGGGAGAAATAGG - Intronic
1167839968 19:52107674-52107696 TAAAAATAACAGGGAAAAACAGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925024544 2:597362-597384 AGAAAATAAGTGGGAAACACCGG + Intergenic
925733266 2:6938145-6938167 AGAGAACATTTGGGAAAACCTGG + Intronic
926110670 2:10181328-10181350 TGAGAATGATTGAGAAGAAAAGG - Intronic
926548204 2:14268797-14268819 TGTGAATAATTTGAAAAAAGAGG - Intergenic
926734971 2:16066570-16066592 AAAGACTAATTGGGAAAAATGGG + Intergenic
926743816 2:16134377-16134399 GGAGAATAATTTGGAAAGTCAGG - Intergenic
926820395 2:16845545-16845567 TGAGAATATTTACGAAAAATAGG - Intergenic
927013601 2:18932350-18932372 TGTTAATAATTGGGAAAAATGGG - Intergenic
927047981 2:19299007-19299029 TGAGGATAATTGGAAAGAATGGG + Intergenic
928113660 2:28529569-28529591 TGAGCCTAATTTTGAAAAACAGG + Intronic
928595335 2:32854645-32854667 TGAGTAGAATTGGGAGAGACGGG + Intergenic
928840658 2:35600474-35600496 TGAAAAGAAAGGGGAAAAACTGG - Intergenic
928912753 2:36439393-36439415 AGAGAATAATTCAGAAAAACAGG - Intronic
929342064 2:40831996-40832018 TGGGAATGATTTAGAAAAACAGG + Intergenic
929350459 2:40945640-40945662 GGAGAAGAATTAGGAAAAACAGG + Intergenic
930097653 2:47578587-47578609 TTAGAATAATTGGAAAATTCAGG + Intergenic
930448109 2:51500430-51500452 TGACAAAAATGGGGAGAAACTGG - Intergenic
931054790 2:58457256-58457278 TGAGAAGAGTTGGGCACAACTGG + Intergenic
931550931 2:63445426-63445448 TGAGAATAAGTGAGAAAATTAGG - Intronic
931988692 2:67767436-67767458 AGAGGATAATGGGGAAAATCTGG - Intergenic
932196569 2:69788935-69788957 TGAGATAAGTTGGGACAAACTGG + Intronic
932202858 2:69847677-69847699 TGCGTATAATGGTGAAAAACTGG + Intronic
932549865 2:72757586-72757608 TGAGGAAAACTGGGACAAACTGG - Intronic
932591094 2:73068200-73068222 TGAGATTAATTGGGGAATAAGGG + Intronic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
933485698 2:82920739-82920761 TGAGAATAAATGGATAAAACAGG - Intergenic
933743483 2:85553156-85553178 TGACAATAGTTGGGAAAGAATGG - Intronic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935946629 2:108292632-108292654 TGATGACAATTTGGAAAAACTGG + Intronic
935959576 2:108411370-108411392 TGAAAATATTTGGGAAAAAATGG + Intergenic
937561160 2:123225311-123225333 TGCCAATAATTTGGAAAATCTGG + Intergenic
939792910 2:146602161-146602183 TCAGAATAAATTGGAAAAAAGGG - Intergenic
940355281 2:152734750-152734772 TGATAATACGTGGGAAAAAAGGG - Intronic
940481101 2:154232352-154232374 TGGGAATAAATGGGAACAAATGG - Intronic
940686546 2:156857784-156857806 TGAGAGTAATTGAGAAAGAATGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941663341 2:168217781-168217803 TGAAAATACTTGGAAAAAAATGG - Intronic
942503396 2:176616195-176616217 TGATAATATTTTGGAAATACTGG + Intergenic
943339359 2:186660328-186660350 TGAGAATAGGTGGGAAAAAAAGG - Intronic
943389711 2:187249930-187249952 TTAGAATAAAGGGGAAAAAAAGG - Intergenic
944188270 2:196973588-196973610 TGAGAAGAACTGGGAAAACCAGG - Intronic
945396959 2:209330635-209330657 TGAGAATGAATGGGAAACACCGG + Intergenic
945549844 2:211207662-211207684 TGAGAATAAGTGGGGGAAAATGG + Intergenic
945635395 2:212342683-212342705 TGATAATATTTGGGATAATCAGG - Intronic
945744068 2:213699194-213699216 TGGGAATAATGGGGAAAATGGGG - Intronic
946223057 2:218245759-218245781 TAAGAAAAATGGGGAAAAAAAGG - Intronic
947154861 2:227152196-227152218 TGGTAATATTTGGGAAAAATTGG + Intronic
947245719 2:228045915-228045937 TGAGAAAAATGGGGAGAAATTGG + Intronic
1170257881 20:14366139-14366161 TGAGATTAATAAGGAAATACAGG - Intronic
1172860829 20:38049852-38049874 GGAGAAGAATCTGGAAAAACAGG - Intronic
1173158931 20:40638281-40638303 AGAGAATAAATGGGAGAAATAGG + Intergenic
1174221215 20:48957048-48957070 TAAGAATAACGGGGAAAAAATGG - Intronic
1174577516 20:51547061-51547083 TGAAAGCAATTGGGAACAACTGG + Intronic
1174841152 20:53902502-53902524 TGAGAGCTATTGGGAAAAAGGGG + Intergenic
1177199296 21:17935722-17935744 GGAGAATAATTAGGAAAGAAAGG + Intronic
1177216145 21:18131541-18131563 TGAAAATAACTGGGGAAAATGGG - Intronic
1177466988 21:21497423-21497445 TGAGAATATTTGGTTAAAAATGG - Intronic
1178664630 21:34535935-34535957 ATAAAATAATTGGGAAAAACAGG + Intronic
1178721201 21:35011205-35011227 TGAGTATTCTTGGGACAAACAGG + Intronic
1179299605 21:40094735-40094757 TAAGAATAATTAGGAAAGACTGG - Intronic
1181866579 22:25861985-25862007 TGAAAATATTTGGAAAAAAAAGG + Intronic
1183766514 22:39881467-39881489 TCAGAAAAATTGGGAAACATCGG - Intronic
1183914075 22:41102632-41102654 TGGGAAGAACAGGGAAAAACAGG + Intronic
1184818417 22:46890044-46890066 CGAAAATATTTGGGAAAAAAAGG + Intronic
1184896931 22:47414371-47414393 TGAGGATGATGTGGAAAAACTGG + Intergenic
949365771 3:3278981-3279003 TGACAAGAATGGGGAAAAAGTGG - Intergenic
949739335 3:7212289-7212311 AGAGAAGAATTAGGAAAACCAGG - Intronic
949969339 3:9390378-9390400 TGAGAATAAATGAAAAAGACAGG + Intergenic
950062881 3:10086785-10086807 TGAAAATAATTTGTAAAATCTGG - Intronic
950933716 3:16817085-16817107 TGAGAAAAATTAAGAATAACTGG - Intronic
951473950 3:23084669-23084691 TGAGATAAAGTGGGGAAAACAGG + Intergenic
953138768 3:40208078-40208100 TTAGCATAATTGGGAATAATTGG + Intronic
955100845 3:55848316-55848338 GAAGAATAATTAGGAAAAAGAGG - Intronic
955580959 3:60421706-60421728 TGATATTAATAGGGAAAAATTGG - Intronic
957398397 3:79675677-79675699 TGAGAAAATGGGGGAAAAACAGG + Intronic
957570857 3:81946203-81946225 TGAGAACAATTAGAAAATACTGG + Intergenic
958648274 3:96901447-96901469 TGAGAAAAGATGGGAAAATCTGG + Intronic
959072778 3:101718404-101718426 TGCAAATGATTAGGAAAAACTGG - Intergenic
960037149 3:113113313-113113335 CAAGAAAAATTGGGAAAAGCAGG + Intergenic
960549832 3:118962797-118962819 TGAGAATAAGAAGGAATAACTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962059612 3:131911747-131911769 TGAGTATAATTGTGAAAAGTTGG - Intronic
962146734 3:132847483-132847505 TTAGAGTAATTGGAAAAACCTGG - Intergenic
964144485 3:153442579-153442601 TGACAAGAATGAGGAAAAACTGG + Intergenic
964576721 3:158178461-158178483 TGAGATTAATCAGGAAAAATAGG - Intronic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
965011673 3:163101133-163101155 TGAGGATACTTGGGGAACACTGG + Intergenic
965328317 3:167335853-167335875 TGAGAATCATTGGGAAAATTTGG - Intronic
965453721 3:168871175-168871197 TGTGAATAATTGGTAAGAAGGGG + Intergenic
965586572 3:170324218-170324240 TGAGAATATTTTGGACATACTGG + Intergenic
965778463 3:172258119-172258141 TGGGAAAAATTGGGACAAAGTGG + Intronic
965889519 3:173494071-173494093 TGTGAAGGAATGGGAAAAACAGG - Intronic
966274207 3:178145184-178145206 AGACAATAATTGGAAAATACAGG + Intergenic
966471333 3:180292584-180292606 TGAGAATTATTGGTAAAGAAAGG - Intergenic
966564053 3:181356362-181356384 CAAGTATATTTGGGAAAAACAGG - Intergenic
967139363 3:186541291-186541313 AGAGAATAATTGAGATAAATGGG - Intronic
967341051 3:188398399-188398421 TGAGAGACATTTGGAAAAACTGG - Intronic
968325811 3:197814307-197814329 CGAGAATAACACGGAAAAACCGG + Intronic
970103904 4:12558332-12558354 TGAGAATAAGTGGCCAAAAACGG + Intergenic
971599520 4:28574232-28574254 TGAGAATAATTAAGAGAAAGGGG + Intergenic
971672197 4:29576180-29576202 TGAGAATAATTAGTAGAAAATGG + Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972174774 4:36389986-36390008 TGAGAATCATCCAGAAAAACAGG + Intergenic
974110386 4:57518954-57518976 TGATACTGAATGGGAAAAACTGG + Intergenic
974340260 4:60605199-60605221 TGAGATTAATTGGTAAAATATGG - Intergenic
975489304 4:74970986-74971008 TGAGCATAGTGGGGAACAACAGG + Intronic
975850001 4:78562526-78562548 TGAGAATTATTGAAAGAAACAGG + Intronic
976926277 4:90500892-90500914 TGATAATAATTGGGAAACAAAGG + Intronic
977510595 4:97957447-97957469 TAAGAATAATTGAGAAAGAAGGG + Intronic
977557607 4:98500807-98500829 TGAGAATAAAGGGCAAAGACAGG + Intronic
977985399 4:103376808-103376830 TTAGAATAATTGATAAAAATAGG - Intergenic
978152912 4:105458388-105458410 TGATAAAATTAGGGAAAAACTGG + Intronic
978482084 4:109204423-109204445 TAGGAATAATTTGGAAAAAATGG + Intronic
978731100 4:112027621-112027643 TGAGAACAAGTTGGAAATACAGG - Intergenic
978926352 4:114250374-114250396 TGAGAATATTTGGCAAGAAATGG + Intergenic
979114418 4:116803928-116803950 TGAGAAGAATTGAATAAAACAGG - Intergenic
979472470 4:121115973-121115995 TAAGAGTAATGGGGAAAAATAGG + Intergenic
979521349 4:121671036-121671058 TCAGAATAATCTGGAAAAATTGG - Intronic
979922868 4:126523904-126523926 TGAGAATAGCAGGGAAAGACTGG + Intergenic
979958536 4:126987507-126987529 TCAGAATAATTGGGCCAAACAGG + Intergenic
979999159 4:127468278-127468300 TGAGAAGAAATTGGAAAAAAAGG - Intergenic
980033558 4:127857757-127857779 TGACAATAATTAGGACATACAGG + Intergenic
980553388 4:134370194-134370216 AGAGAAGAATGGGGAAAAAAAGG - Intergenic
980690352 4:136289096-136289118 AGAAAATAATTGGGAAAGAGTGG - Intergenic
980919225 4:139065709-139065731 TGATTTTAATTGGTAAAAACTGG + Intronic
981101703 4:140836206-140836228 TGAGAGAATTTGGGAAAAAAAGG - Intergenic
981610263 4:146586359-146586381 TGAGAATAAGAGGGATAAAGAGG - Intergenic
981628880 4:146794537-146794559 TGAGAAAACTTGGGAAAATTTGG - Intronic
983105004 4:163675946-163675968 AGAGAAATATTGGGAAAAATAGG - Intronic
984294332 4:177834880-177834902 GGAGAATAATTGGAAATAATTGG + Intronic
984359752 4:178713202-178713224 TGAGAATAATTGATAAAAGTTGG - Intergenic
984660626 4:182370658-182370680 TAACAATACTTGGGAAAACCTGG - Intronic
984716739 4:182933126-182933148 AAAGAAAAATTGGGAAATACAGG - Intergenic
984808777 4:183775880-183775902 TGAGTAAAATTGGGAAGCACTGG - Intergenic
985258163 4:188090064-188090086 TGAGAACATTTGAGTAAAACTGG + Intergenic
986213317 5:5694694-5694716 TGGGCAAAAATGGGAAAAACTGG - Intergenic
986621585 5:9681259-9681281 TGATAAAAATAGGGAAAAATGGG + Intronic
986931946 5:12835905-12835927 TGAGAATATTTGTGAAAGATGGG + Intergenic
988330114 5:29826472-29826494 TGTGTATAATTGGGTAAAAATGG - Intergenic
988351863 5:30118844-30118866 AGAGAAAAACTGGCAAAAACTGG - Intergenic
988520996 5:31945627-31945649 AGAGAACAAGGGGGAAAAACAGG - Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
988835314 5:35026572-35026594 TTAGAAACATGGGGAAAAACAGG + Intronic
989198370 5:38738120-38738142 TGTGAATAATTGGAATTAACAGG + Intergenic
989268516 5:39504923-39504945 TGGGAATAACTGGGAAATGCAGG - Intergenic
989499849 5:42152771-42152793 TGAGAAGAAATGGGAGAAAAGGG + Intergenic
991214239 5:64143726-64143748 TAAGAAAAATTGGGAGAAACAGG + Intergenic
992178975 5:74178427-74178449 TTAGAATCATTGAGAATAACAGG - Intergenic
992207168 5:74442225-74442247 TGAGAGAGATTGTGAAAAACTGG - Intergenic
993102365 5:83556498-83556520 TGAGAAAAATAGGGAAAAATAGG + Intronic
993533498 5:89052016-89052038 TGAGAATAAATGGAAGAAAAAGG + Intergenic
993776671 5:92008541-92008563 TGAGAATAATTTTGATAAAAAGG - Intergenic
993842563 5:92898747-92898769 TGAGAAGAAGTGGAAAAAATAGG - Intergenic
994063819 5:95511598-95511620 TCAGATAAATTGTGAAAAACAGG - Intronic
994657225 5:102608942-102608964 TAAAAATAATTAGGAAAAAAAGG - Intergenic
994889277 5:105608896-105608918 TGACAATAAATTGGAAAACCTGG + Intergenic
995065133 5:107853170-107853192 TGAGGATATTTGGCAAAACCAGG - Intergenic
995377792 5:111496295-111496317 TCAGAATAATTTCAAAAAACAGG - Exonic
996493365 5:124125476-124125498 TGAAAATATTTGGGAAAGACTGG + Intergenic
996759022 5:126968370-126968392 TGACAAGAATTTGGAGAAACCGG - Intronic
996843764 5:127877320-127877342 AGAGAATAATGGGCAAAAAAAGG - Intergenic
997773471 5:136576031-136576053 AAAGCATATTTGGGAAAAACAGG + Intergenic
998708300 5:144790651-144790673 TGAAAATATTTGGGAAAAAATGG - Intergenic
998905123 5:146896820-146896842 TTAGTATAATTGGGGAAAAGTGG + Intronic
999109434 5:149105548-149105570 TGAGAATATTCAGGAAAAAAAGG - Intergenic
1001376667 5:171266111-171266133 TGAGAAAAATTAGACAAAACCGG + Intronic
1003401101 6:5791664-5791686 TGAGAAGAATGGGGAAATGCTGG - Intergenic
1003757382 6:9136977-9136999 TAAGAATACTTGGGAAAATGAGG + Intergenic
1006575249 6:35040441-35040463 TGGGAATAAGTGAGAAAAGCTGG - Intronic
1006647241 6:35523050-35523072 TGAGGATAACTGGGAATACCAGG + Intergenic
1006976922 6:38111279-38111301 TGAAAATATTTGGGAAAAAATGG + Intronic
1007729566 6:43937718-43937740 TGAGAACATGTGGGAAAAGCTGG - Intergenic
1008206074 6:48658985-48659007 AGACAATAATTGGGAAGAACTGG - Intergenic
1008227746 6:48942407-48942429 TCAAAATAATTGGGAAACATAGG - Intergenic
1008531832 6:52468440-52468462 TGAGTATATTCAGGAAAAACAGG + Intronic
1009518155 6:64646427-64646449 TGAGAATATTTGGGAAAAGAAGG - Intronic
1010367875 6:75073004-75073026 TGAGAATAATTTTAATAAACTGG + Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1011781286 6:90792305-90792327 TGAGGATAATGGGAAAAAATGGG + Intergenic
1012227896 6:96725659-96725681 TGAGAATATTTGGAAGAAAGTGG - Intergenic
1012805087 6:103883846-103883868 TGAGAATATTTGGGAAACACTGG - Intergenic
1012822845 6:104109651-104109673 CTAGAATAATTGGGGAAAATAGG + Intergenic
1013004599 6:106060602-106060624 TGAGAACAAGTGGTAAATACTGG + Intergenic
1013145719 6:107389322-107389344 TGAGAATATGGGGGAAAAAAAGG + Intronic
1013773299 6:113650958-113650980 AGAGATTTATTAGGAAAAACGGG - Intergenic
1013878276 6:114861483-114861505 TTAAAATAATTGAGAAAAAAAGG + Intergenic
1014160957 6:118167953-118167975 TGTGAATAAGTGGGGAAGACAGG - Intronic
1014375406 6:120665941-120665963 TGAGAAAAGCTGGGAAAAGCTGG + Intergenic
1014920796 6:127212732-127212754 TGAGAATGATGGAGAAAATCAGG - Intergenic
1015027738 6:128557462-128557484 GGAAAATAATTGGAACAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016101350 6:140105171-140105193 TATGCATAATTGGGAAACACTGG - Intergenic
1016177735 6:141100568-141100590 TGAGATTAATTAGGAAGAAAAGG + Intergenic
1016357686 6:143235863-143235885 AGAGAAGAATTGGAAAAAACAGG - Intronic
1016459723 6:144269798-144269820 TAATAAAAATTGGAAAAAACAGG - Intergenic
1017788621 6:157776202-157776224 TGCTAATAATTGGGAAGCACAGG + Intronic
1018179864 6:161213521-161213543 TAGGAAAAATTGGGAAAAAAAGG - Intronic
1018653675 6:166011765-166011787 TGACAATAAATGAGAAAAATAGG + Intergenic
1018663613 6:166113220-166113242 TGAGAATAAATGGGAGAAAGTGG + Intergenic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1019819671 7:3233173-3233195 TGAGAACAATCAGGACAAACAGG - Intergenic
1021274049 7:18627051-18627073 TGAGAATAACTGTGAAGATCTGG - Intronic
1022995241 7:35748748-35748770 TGAGAAACATTGGATAAAACTGG - Intergenic
1023721371 7:43098727-43098749 TGAGAATAATTAGAAAAAGAAGG + Intergenic
1024221995 7:47296138-47296160 TGAGTATAATGGGGCAAAAAGGG + Intronic
1024723519 7:52166072-52166094 TGAGGATAAAAAGGAAAAACAGG - Intergenic
1024832391 7:53476405-53476427 TGAGAGTAATTGGAAAATACAGG - Intergenic
1026630554 7:72034051-72034073 TGAAACTAATTAGGAACAACAGG + Intronic
1027489551 7:78805784-78805806 TGTGAATAATAGGGAACAGCAGG + Intronic
1027796537 7:82700781-82700803 TGATAATTATTTGGAAAAGCAGG - Intergenic
1028236062 7:88363020-88363042 GGAGAATAAATGAGAAAAAAAGG - Intergenic
1028293982 7:89104627-89104649 TGAAAATAAGAGGGAAAAAAAGG - Intronic
1028447962 7:90946459-90946481 TGAAAATAATTCAGAAAACCTGG + Intronic
1028834491 7:95359255-95359277 TGAAAATATTTGGAAAAAAATGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029997838 7:105026763-105026785 TGAGAATAATTGTGAGAAACTGG + Intronic
1030356609 7:108550359-108550381 TGAGAACAATGGGCAAAAACAGG - Intronic
1030778189 7:113563260-113563282 TGAGAATAATGGGCAACAAGAGG + Intergenic
1030861260 7:114632817-114632839 TTAGAATAACTCAGAAAAACAGG - Intronic
1031059326 7:117032346-117032368 TGTGAATATTTGGCAAGAACTGG - Intronic
1031427209 7:121620275-121620297 TGAGAAAAATGGGGAAAAAATGG + Intergenic
1032378809 7:131453545-131453567 TATGAATAAATGGGAAAATCTGG + Intronic
1032897714 7:136269937-136269959 TGAAAGTATTTGGGAAAAAATGG + Intergenic
1033441656 7:141385652-141385674 TGAGAATAAGCAGGATAAACAGG - Intronic
1033947414 7:146738095-146738117 TTAGTACAATTGTGAAAAACAGG - Intronic
1034530244 7:151691673-151691695 TGACAATGATTTGGAACAACAGG + Intronic
1034852271 7:154505319-154505341 TGATAATAATAGGGGAAAATGGG - Intronic
1035120530 7:156563076-156563098 TAAGAATTATTGGGATAAAATGG + Intergenic
1035735290 8:1882973-1882995 TGAGAATCATTGAGAATCACTGG + Intronic
1035909537 8:3550284-3550306 TGGGAATTATTGGAGAAAACAGG - Intronic
1036975757 8:13410274-13410296 TGAGGATAATGAGGAAACACTGG + Intronic
1037339380 8:17827011-17827033 TAAGAAAAATTAGGAAAAAATGG + Intergenic
1038119788 8:24600231-24600253 TCAAAATAATTTTGAAAAACAGG + Intergenic
1038860578 8:31384527-31384549 TGCCAATAAATGGGAAAACCTGG + Intergenic
1038956751 8:32476139-32476161 TGACAAAAATTGGGGAAAAAAGG + Intronic
1040522029 8:48185904-48185926 TGAGAAAAAATAGGAAAAACAGG - Intergenic
1040588963 8:48771511-48771533 AGAGCATAATAAGGAAAAACTGG - Intergenic
1041940523 8:63382198-63382220 TGAGAACAATTAGGAAAACCTGG - Intergenic
1042075799 8:64993348-64993370 TGAGAACATTTGGGAAATCCTGG - Intergenic
1042166288 8:65949009-65949031 TGAGGAGAATTAGGAAAGACAGG - Intergenic
1042673333 8:71288051-71288073 TGAATACAATTAGGAAAAACTGG - Intronic
1043201873 8:77380431-77380453 TGTTAATAACTAGGAAAAACAGG - Intergenic
1043203790 8:77409421-77409443 TGAGCAGGATTGTGAAAAACTGG + Intergenic
1043280664 8:78461596-78461618 TGAGAATAATTTTGAAGAATTGG + Intergenic
1043510994 8:80950073-80950095 TTACAATAATTCGGAAAAAGTGG - Intergenic
1043655988 8:82665615-82665637 TGAGAAGAAATGGGAAGAAAAGG + Intergenic
1043742551 8:83832436-83832458 TCATATTAAATGGGAAAAACTGG - Intergenic
1044051074 8:87505125-87505147 TGAGAATATTTAGGAAAAAATGG - Intronic
1044369581 8:91392968-91392990 TGAGAAGAATTGTGAAATAATGG - Intronic
1044703997 8:94990874-94990896 TGAGCATAAATGGGGAAACCTGG - Intronic
1044861782 8:96530912-96530934 TGAAAATGGTTGGGAAACACTGG - Intronic
1045745516 8:105415149-105415171 TGAGAATAACTGGGAAATTCTGG - Intronic
1045792887 8:106006444-106006466 TGAAAATATTAGGGAAAAGCAGG - Intergenic
1046519709 8:115308866-115308888 TGAAAATATTTGGAAAAAAATGG + Intergenic
1047162597 8:122397341-122397363 TGAGATTAATTTAGAAAAGCTGG - Intergenic
1047375016 8:124287736-124287758 TGAGACGAATCTGGAAAAACGGG - Intergenic
1048982079 8:139707924-139707946 TGAGAAACATTGGGTTAAACGGG + Intergenic
1049077685 8:140412657-140412679 TGATAACAACTGGGAAATACGGG + Intronic
1050312153 9:4364274-4364296 TGAAATTAATTCTGAAAAACTGG + Intergenic
1051347685 9:16167510-16167532 TGAGAATAATAGAGAAAACCTGG + Intergenic
1051558046 9:18406940-18406962 TGAGAATAAATGTGAAAAGCAGG + Intergenic
1052845746 9:33334821-33334843 TATTAATAATGGGGAAAAACTGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1053561853 9:39204458-39204480 TAAGAATAGTAGGGAAAAAATGG + Intronic
1053827663 9:42042477-42042499 TAAGAATAGTGGGGAAAAAATGG + Intronic
1054135265 9:61414494-61414516 TAAGAATAGTAGGGAAAAAATGG - Intergenic
1054602898 9:67144965-67144987 TAAGAATAGTGGGGAAAAAATGG - Intergenic
1055535749 9:77241849-77241871 TGAGAAAAATTAGGAGAAAAAGG - Intronic
1055720705 9:79170745-79170767 TGAGAATAAGAGGGAAACTCAGG + Intergenic
1055750883 9:79503662-79503684 GGAGATCAACTGGGAAAAACTGG + Intergenic
1055890204 9:81116086-81116108 TGACAATCATTGTGATAAACAGG - Intergenic
1057974738 9:99593342-99593364 TGAGAAAAATTGGCACAAAGAGG + Intergenic
1058092532 9:100821619-100821641 TAGGAATAATTGGGAAAAGGAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058528444 9:105883241-105883263 TGAGAGTCATTGGGAGACACGGG - Intergenic
1060072437 9:120562097-120562119 TGTGTATAATTGTGAAAAACTGG - Intronic
1061085256 9:128394315-128394337 TGAGGTTCATTGGGAAAGACAGG - Intergenic
1187314363 X:18178964-18178986 ACAGAATGATTGGGAAAAATTGG - Intronic
1188690734 X:33125129-33125151 TGAAAACAAAAGGGAAAAACTGG + Intronic
1189124311 X:38429764-38429786 TGAGAATAATTGGGAAAAACAGG + Intronic
1189172467 X:38923221-38923243 TGTGAAGATTTGGGTAAAACAGG - Intergenic
1189698838 X:43695353-43695375 TGGGAAAAACTGGAAAAAACTGG + Intronic
1190130847 X:47747661-47747683 TGAGAATACTAGGGAAAATGAGG - Intergenic
1190302478 X:49064784-49064806 TGAGAAGAGTTGTGACAAACTGG + Intronic
1190735635 X:53254365-53254387 TGAGAATAATGAGAAAGAACTGG - Intronic
1191004227 X:55693605-55693627 TGACATTAATTGGGAAAGAGGGG + Intergenic
1191058343 X:56267447-56267469 TGAGAATAGCAGGGGAAAACTGG + Intronic
1191185064 X:57602698-57602720 TCAGTATAATTGGAAAATACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192680258 X:73246174-73246196 TGATAAAAATTCTGAAAAACTGG + Intergenic
1193195422 X:78625950-78625972 TGAGATTATTGTGGAAAAACTGG + Intergenic
1193736015 X:85157452-85157474 AGAAAATAATTGGGAAAAATGGG - Intergenic
1193914393 X:87347947-87347969 TTATAATAATTGGTAAAATCAGG - Intergenic
1194031705 X:88825205-88825227 TGAGAATAATGGGGAAACTTTGG - Intergenic
1194193389 X:90864624-90864646 AGAGAATAATTAAGAAAAATTGG + Intergenic
1194336181 X:92649427-92649449 TGATGATAATATGGAAAAACAGG + Intergenic
1194693637 X:97017790-97017812 TGCCAGTAATTGGGAAAAAAGGG - Intronic
1194724887 X:97384337-97384359 TGAGATGAAATGTGAAAAACGGG + Intronic
1194953714 X:100155285-100155307 TGCCAATAAATGGGAAAATCTGG - Intergenic
1195443903 X:104928792-104928814 AAAGAATAATGGGGAAAAATTGG + Intronic
1196469520 X:116010222-116010244 TGAGCATGATGGGGAGAAACAGG - Intergenic
1197789060 X:130232692-130232714 TGATAAGAATGTGGAAAAACGGG + Intronic
1200540000 Y:4447007-4447029 AGAGAATAATTAAGAAAAATTGG + Intergenic
1200644613 Y:5766174-5766196 TGATGATAATATGGAAAAACAGG + Intergenic
1200753516 Y:6968492-6968514 TGAGGATAATAGGTAAAAAGAGG + Intronic
1201954329 Y:19606032-19606054 TGAAAATAACTGTGAAAAAAAGG + Intergenic
1202297054 Y:23370225-23370247 TGAGAATAACTAGAAAAAGCTGG + Intergenic
1202573753 Y:26300372-26300394 TGAGAATAACTAGAAAAAGCTGG - Intergenic