ID: 1189125470

View in Genome Browser
Species Human (GRCh38)
Location X:38441285-38441307
Sequence AAGCAGTGAAATGTGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189125468_1189125470 23 Left 1189125468 X:38441239-38441261 CCTTTTGAATACAATGGCAGTAT 0: 1
1: 0
2: 1
3: 9
4: 190
Right 1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG 0: 1
1: 0
2: 1
3: 22
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189125470 Original CRISPR AAGCAGTGAAATGTGGTTCA TGG Intronic
902823703 1:18958196-18958218 AAGCAAGGAACTGTGGTTGAGGG - Intergenic
903109798 1:21121878-21121900 AGGCAGTGAAATGTGTATAATGG - Intronic
903529440 1:24018937-24018959 AACCATTGGAATGTGGTGCAGGG - Intergenic
905293005 1:36935832-36935854 AGGCAGGAAAATGTGGTTAATGG + Intronic
905965737 1:42093627-42093649 TAGCAGTCCAATGTGGTGCAGGG + Intergenic
906705693 1:47893570-47893592 AAGCATTGAAATGTGAGGCAAGG - Intronic
910061213 1:83094936-83094958 AAGGATTGAACTGTGTTTCATGG - Intergenic
910596437 1:88985713-88985735 AAGCAGAAAAATATAGTTCATGG + Intronic
912509826 1:110181617-110181639 AAGCAGAGAAAGGAGGTTTAGGG + Intronic
912719941 1:112011665-112011687 AAGCAGTGCACAGTGGTTCCAGG - Intergenic
913088445 1:115459829-115459851 AAGCCCTGAAATGTGGTTACAGG - Intergenic
914387327 1:147182753-147182775 CAGCAGTGAAATGAGGGTCAAGG + Intronic
914448052 1:147766834-147766856 ATACAGTGGAATGTGGTGCAGGG + Intronic
916072839 1:161181355-161181377 GATCATTGAAATGTGGTTCTTGG + Intergenic
918765745 1:188481033-188481055 AATCAGTGAATTGTGGTAAAAGG - Intergenic
919914838 1:202132917-202132939 AACCAGTTAACTGTGCTTCAGGG - Exonic
920712194 1:208305991-208306013 AAGCAGTAAAATTTTGATCAGGG + Intergenic
921422784 1:214967616-214967638 AAGCAAGGAAATCTGGTTGAAGG - Intergenic
921480023 1:215653763-215653785 AAGTATTGAAGTGTAGTTCAGGG + Intronic
921844245 1:219862001-219862023 AAGAATATAAATGTGGTTCAGGG + Intronic
923000873 1:230005398-230005420 AGGCAGTGAAATTTAGCTCAGGG + Intergenic
923140156 1:231155061-231155083 AATCAGTCAAATGTGGTTGCTGG + Intergenic
923562467 1:235051640-235051662 GAACAGTAAAATGAGGTTCAGGG + Intergenic
923636347 1:235701039-235701061 AAGCATTTAAATGGGGGTCAGGG + Intronic
1066313460 10:34220662-34220684 AAGCTGTGAAATGGGGGTGATGG + Intronic
1067217546 10:44315695-44315717 AAAGAGTGAAAGGTGGTTCTGGG - Intergenic
1067325766 10:45264586-45264608 ATGCAGAGACATGGGGTTCAAGG - Intergenic
1067963524 10:50883260-50883282 AAGGAGAGAAATGTGGTCCCCGG - Intronic
1068849694 10:61722793-61722815 CCGCAGAGAAATGTGGTTGAAGG + Intronic
1071731751 10:88255222-88255244 AAGCAATGAAAGGTGGTTCCAGG - Intergenic
1072770212 10:98131738-98131760 AAACAGTGAAATGTGGCCTATGG - Intergenic
1072943027 10:99784529-99784551 AAGCAGTGGGATGTGCTGCAGGG + Intronic
1073655706 10:105413062-105413084 AATCAGTTAAATTTGGTTTAAGG + Intergenic
1073798147 10:107011272-107011294 AAGAAGTGAAAAGTGGTTTAAGG - Intronic
1075178088 10:120184352-120184374 ACACAGTGAAATGAGGTGCAAGG - Intergenic
1075418843 10:122285936-122285958 AAGCAGTGAAGTGTGGGCCTCGG - Intronic
1079223199 11:18582749-18582771 AAGCAGTGCCATGTGCTTAAAGG + Intronic
1079924884 11:26481585-26481607 AAATGGTGAAATGTGTTTCAAGG + Intronic
1080061749 11:27963622-27963644 AATCAGTCAAATGTGGATAATGG + Intergenic
1081558560 11:44190789-44190811 AAGCAGAGAAAGGTGGTAAACGG - Intronic
1081565887 11:44261053-44261075 AAGAAGTGAAGTGGGGTTGATGG + Exonic
1081573707 11:44306676-44306698 AAGCGGAGAAATGGAGTTCAAGG - Intronic
1082836312 11:57653191-57653213 AGGCAGAGAAATGTGGGTAATGG + Intronic
1085486484 11:76868057-76868079 AAGCAGTCAAATGCCTTTCATGG - Intronic
1085693840 11:78687332-78687354 AAGCAGTGAAAGGAGCCTCAGGG - Intronic
1085695086 11:78697287-78697309 AAGCAGCAAGATGTGGTGCAGGG + Intronic
1089021846 11:115223889-115223911 AAGCAGTGAATTGAGTTTCAGGG - Intronic
1090929962 11:131288605-131288627 AAAGAGAGAAATGTGGTTCTGGG - Intergenic
1090930936 11:131297559-131297581 AAGAAGTGAAGTGTGGTCCTGGG - Intergenic
1091883116 12:3995678-3995700 AAGCTGTGCTCTGTGGTTCAGGG + Intergenic
1093003964 12:14032069-14032091 AAGGTCTGAAATGTGTTTCATGG - Intergenic
1096460378 12:51818831-51818853 AAGGAGAGAAATATGGTTCTTGG + Intergenic
1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG + Intronic
1099006170 12:77236975-77236997 ATGGAATGAAATTTGGTTCAGGG - Intergenic
1099438752 12:82675239-82675261 AAGCAGTACAATGTGGTTGAAGG + Intergenic
1100521359 12:95379167-95379189 AAGCATTGAAATGTGCTGTAAGG - Intronic
1101040690 12:100752485-100752507 AAGCAGTGACATCTGTTTAATGG - Intronic
1101181263 12:102220689-102220711 AGCCAGTGAAATGTGGTTAATGG + Intergenic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1104912578 12:132246495-132246517 AAGCAGTGAATTCTGTTTCACGG + Intronic
1106258545 13:28043829-28043851 AAGCCAGGAAAGGTGGTTCACGG + Intronic
1106790518 13:33151257-33151279 AAGAAGTTTAATTTGGTTCATGG + Intronic
1106891975 13:34255466-34255488 ACTCAGTGAAATGTGGTTCTTGG - Intergenic
1108830003 13:54465437-54465459 AATAAGTGAAATGTGGAGCAGGG + Intergenic
1109844950 13:67976569-67976591 TATCAGTGAAATGTGTTACAGGG + Intergenic
1111371408 13:87322650-87322672 TAGCAGTGATCTGTGTTTCACGG + Intergenic
1111818271 13:93182338-93182360 AAACAGAGAAATGGGCTTCAGGG - Intergenic
1112382721 13:98907796-98907818 AGGTAGAAAAATGTGGTTCAGGG + Intronic
1114916596 14:27275001-27275023 AGCCAGTTGAATGTGGTTCATGG + Intergenic
1115731944 14:36279496-36279518 AAACAGTTAAAAGTGGTGCATGG - Intergenic
1117015444 14:51512925-51512947 CAGCAGTGAAAAGTGCCTCAAGG + Intronic
1118377784 14:65191889-65191911 AGGCAGAGATATGTGGTACATGG + Intergenic
1118560102 14:67070131-67070153 TAGCAGTGTAATGAAGTTCATGG - Intronic
1119841582 14:77797430-77797452 AAGAAGAAAAATGTGTTTCAAGG - Intergenic
1121194315 14:92056205-92056227 ATGTAGTGACATGTGGCTCAGGG + Exonic
1122430441 14:101636772-101636794 TAGAAGTGGAATGGGGTTCAGGG + Intergenic
1125754308 15:42052212-42052234 AAACTGTGAAATGTGGTGCAGGG - Intergenic
1127201585 15:56659389-56659411 AGAAAGTGAAATGTGGTTAACGG - Intronic
1128751330 15:70152273-70152295 ATGCAGTGAATTGTGGTTCTTGG + Intergenic
1130192782 15:81752158-81752180 AAAGAGTGAACTGTGATTCAGGG - Intergenic
1130739705 15:86585949-86585971 AAGCAGTGGAATGTGGAGCATGG - Intronic
1134837669 16:17375773-17375795 AAGCGTGGAAATGTGGTTCCAGG - Intronic
1135494243 16:22937674-22937696 CAGCTGTGAAATGGTGTTCATGG + Intergenic
1138510358 16:57505217-57505239 AAGGAGGGAAAGGTGGTTCTAGG + Intergenic
1140966854 16:79974988-79975010 AAGAACTGAAATGTGGTCTAAGG - Intergenic
1144191359 17:12849501-12849523 AAGCAGAGAGATTTGGTTCCAGG - Intronic
1146417428 17:32648854-32648876 AAGCAGAGAAATGTGGAAAAGGG - Intronic
1146560785 17:33867897-33867919 AAGCAGGGACATGGGGTTTAGGG + Intronic
1146565387 17:33908585-33908607 ATGTAGTGATATGTGTTTCAAGG - Intronic
1149220309 17:54409128-54409150 AAGCAGAGAAAAGTGCTTCAAGG - Intergenic
1149704923 17:58686359-58686381 AAGGATGGATATGTGGTTCATGG + Intronic
1151637614 17:75362391-75362413 AAGGATTGAAATTTGGTTCTTGG - Intronic
1153749145 18:8211255-8211277 AAGGGGTGAAATGTGGGGCATGG + Intronic
1155732626 18:29180019-29180041 ATGGAGTAAAATGTGATTCAGGG - Intergenic
1157785750 18:50481160-50481182 AAGCAGTAAAGTGAGGCTCAGGG + Intergenic
1158993225 18:62891437-62891459 AATCAGCCAAATGTGGTTCTCGG + Intronic
1160079609 18:75712813-75712835 AAGCAGTGAATGTTGGTTCTTGG - Intergenic
1162285947 19:9738965-9738987 AAGAAGTGAAATGTGTGTCTTGG + Intergenic
1165019404 19:32911212-32911234 AAGCATTGTTATGTGGTACATGG + Intronic
924960216 2:28026-28048 AAGCAGTGAATTGTGCTGCCAGG + Intergenic
925219642 2:2127788-2127810 ATGCAGGGAAATGTGATTCTGGG - Intronic
925924713 2:8661723-8661745 AAGCAGAGAAAAGTACTTCAGGG + Intergenic
926764523 2:16312628-16312650 AAGCAGGGGAAAGTGGGTCATGG + Intergenic
927587050 2:24317426-24317448 AAGCAGTGGAATGTGCATAAAGG - Intronic
928216325 2:29364401-29364423 AAGCAGTGACATGAAGTCCATGG - Intronic
929546365 2:42857408-42857430 AAACAGTGGCATGTGGTTCCCGG + Intergenic
929943690 2:46354182-46354204 ATGCTGTGAAATGTCGTTCAAGG - Intronic
930920352 2:56745921-56745943 AATCAGTGAATAATGGTTCATGG - Intergenic
931175855 2:59854343-59854365 AATCAGTAAAATATGGTTCAGGG + Intergenic
931192817 2:60022180-60022202 AAGCAGTGAGAAGAGGTTTAGGG + Intergenic
935583857 2:104783430-104783452 AAGAAGAGAAATGGGTTTCATGG + Intergenic
935597200 2:104888540-104888562 AAAAAGTGAAATGTCTTTCAAGG + Intergenic
936264818 2:110995943-110995965 AAGCAGTGAAATTTCGTGAAAGG + Exonic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936835577 2:116705834-116705856 CTGCAGTGAAATTTGTTTCAAGG + Intergenic
936981600 2:118269983-118270005 AAGCTGGAAAATGTGGTTCTGGG + Intergenic
937492505 2:122384443-122384465 AAACATTGCAATGTGGTACAGGG + Intergenic
938653082 2:133403819-133403841 CATCAGTAAAATGTGTTTCATGG - Intronic
940962023 2:159797197-159797219 ACGCAGTGAAATCTGGGGCAAGG + Intronic
941688324 2:168470441-168470463 AAGCCATGAAATGTGGCACAGGG - Intronic
941964092 2:171283543-171283565 AAGCAGTAAAGTGTGGTGCCAGG - Intergenic
942654720 2:178203577-178203599 AAGCAGGGAAATATGACTCATGG - Intronic
943785137 2:191869031-191869053 AACCCATGAAATGTGGTTAAAGG - Intergenic
943876583 2:193073844-193073866 AAGCAGGGAAAGGGGCTTCAAGG - Intergenic
945428706 2:209739223-209739245 AAGCATTGAAATGTGTTCCGTGG - Intergenic
946491827 2:220156167-220156189 AAGCAGAGAAGTGTGGTGCCAGG - Intergenic
948093542 2:235315543-235315565 AAGCATAGAAATCTGGGTCAAGG + Intergenic
948232397 2:236359593-236359615 GAGCAGCAAAATATGGTTCATGG - Intronic
1169777946 20:9276570-9276592 AAGCAGTGAATTGAGATCCAGGG + Intronic
1170249588 20:14265465-14265487 ATTCAGTGAAATTTGGTACATGG - Intronic
1173240957 20:41296831-41296853 GAGCAGTGAATTTTGGTTGAGGG - Intronic
1174436916 20:50514914-50514936 AACCAGTGAAATGTGGCAGAGGG - Intronic
1175786780 20:61716965-61716987 AGGCTGTGGAATGTGGTTCTTGG + Intronic
1175937907 20:62523399-62523421 AGGGAGTGAAATGGGGTTCCAGG - Intergenic
1178600472 21:33990121-33990143 ACACGGTGAAATGTGCTTCATGG - Intergenic
1178735937 21:35151024-35151046 AAGAAGAGAACTGTGTTTCATGG - Intronic
1182379177 22:29872563-29872585 AAGCAGAGAACTGGGGTTGAGGG - Intergenic
1182845668 22:33428960-33428982 AAGGAGAGAACTGAGGTTCAAGG + Intronic
1183787887 22:40041673-40041695 AAACAGTGGGATGTGGTTCAGGG - Exonic
949171541 3:1004858-1004880 CAGGTGTGAAATTTGGTTCAAGG - Intergenic
949473144 3:4417739-4417761 AAGCAGTGATATGTAACTCAAGG + Intronic
950179390 3:10900678-10900700 TAGCAAAGAAATGTGGTTCTGGG + Intronic
951822230 3:26826096-26826118 AACCAGTGAAATATGGATGAAGG - Intergenic
953548229 3:43880377-43880399 AAGCTGTGAAATGTGAGGCAGGG - Intergenic
954794549 3:53154937-53154959 AAGCGGTGGAATTTGGGTCAAGG - Intergenic
955199775 3:56840498-56840520 AAACAATGAACTGTGGCTCAGGG - Intronic
957195242 3:77059295-77059317 AAGCAGTGAAAGGTGGAAGAAGG + Intronic
957517888 3:81279478-81279500 ATGCAGTGAAATGTGATTCCTGG - Intergenic
959849298 3:111069953-111069975 TAGCAGTGAAATTAGGTTTAGGG + Intergenic
960843939 3:121989274-121989296 AAACAATGAAATGTGGTAAAAGG + Intronic
962181433 3:133209872-133209894 AAGGAGAGAGATGAGGTTCAGGG - Intronic
966937356 3:184719725-184719747 AAGCAGTGAAAGGAGGTTCTGGG + Intergenic
968107998 3:196016115-196016137 AAGCAGTGAATTGTGCTGCCAGG + Intergenic
970553638 4:17209494-17209516 ATGCCATGAAATGTGGTCCAAGG - Intergenic
970713509 4:18892844-18892866 AAACAGTAAACTGTGGATCAGGG - Intergenic
971869132 4:32213228-32213250 TAGCAGTGATATGTAGTGCATGG - Intergenic
972134816 4:35878730-35878752 AAGGAGTGAAGTGTGGATGAAGG - Intergenic
972864320 4:43211705-43211727 CATCAGCGAAATGTGGCTCATGG - Intergenic
976316715 4:83666556-83666578 GAGCAGGTAAAAGTGGTTCAGGG + Intergenic
977414643 4:96716952-96716974 AAGCTGTGAAATGTCATTAATGG - Intergenic
981166988 4:141571977-141571999 AAGCAGTGACGTGTGATTAATGG + Intergenic
982018469 4:151179931-151179953 GAGCAGTGACATGATGTTCAGGG + Intronic
982608773 4:157547314-157547336 ATTCAGAGAAATGTGGTTAATGG - Intergenic
983529733 4:168796978-168797000 AAGCAATGAATAGTGCTTCAAGG + Intronic
983809128 4:172036317-172036339 CAGCAGTGAACTGTATTTCATGG - Intronic
984850096 4:184145133-184145155 AACAAGTGAACTGTGTTTCAGGG - Intronic
985091655 4:186369359-186369381 ACGCAGTGAACTGTGGCTAATGG + Intergenic
986345605 5:6832454-6832476 AAACAGAGAAATGTGGTGTAGGG - Intergenic
987021913 5:13882903-13882925 GAGCAGTGAACTGTTGTCCAAGG - Exonic
987150198 5:15030932-15030954 ATGCAGTGTAAAGTGCTTCAAGG + Intergenic
989352678 5:40504486-40504508 AGGCACAGAAGTGTGGTTCAAGG + Intergenic
989806594 5:45615100-45615122 AAGCAGTGAAATCTGGTTACAGG - Intronic
993802902 5:92366149-92366171 AAGTAGTGTACTGTTGTTCAAGG + Intergenic
994684961 5:102938798-102938820 TTTCAGTGAAATGTAGTTCAGGG + Intronic
994855082 5:105110080-105110102 AAGCAGAGACATTTGTTTCAGGG + Intergenic
996229543 5:121044300-121044322 AACCAGTGAAATATACTTCATGG - Intergenic
997456943 5:134024721-134024743 AACCAGTGGAATGTGGTTGCAGG + Intergenic
999523127 5:152373174-152373196 AAGAAGTAGAATGTGGATCATGG - Intergenic
999957122 5:156714714-156714736 ATCCAGTGAAATTTAGTTCAAGG + Intronic
1000055612 5:157603499-157603521 AATCATTGAAATGTGGTGCATGG - Intergenic
1003989028 6:11467450-11467472 TAGCAGTGAATTGTGGTTCAAGG + Intergenic
1006111472 6:31748735-31748757 AAGCAGTATAATGATGTTCAGGG + Intronic
1011163914 6:84424639-84424661 AAAAGGTGAAATTTGGTTCAAGG - Intergenic
1011486814 6:87850915-87850937 AAGCAGAGAAATGAGCTTAAGGG - Intergenic
1014326590 6:120003995-120004017 AAATAGGTAAATGTGGTTCATGG - Intergenic
1016244393 6:141965515-141965537 AAGAAGTGAAGTGTGGTGAAGGG - Intergenic
1018002782 6:159594528-159594550 AAGCAGGGAGCTGTGGTTCAGGG + Intergenic
1020591329 7:10141604-10141626 CAGCAGTGAGATGTGCTGCAAGG + Intergenic
1022260913 7:28704005-28704027 AAGTAGTGAAATGTTTTTCCTGG + Intronic
1022386107 7:29900839-29900861 AGACAGTGCAATGTGGTGCAAGG - Intronic
1023276282 7:38522123-38522145 AAGAATTAAAATGTGGTTCTTGG - Intronic
1028155789 7:87427815-87427837 TATCACTGCAATGTGGTTCAAGG - Intronic
1028775203 7:94668172-94668194 AAACAGCCAAATGTGGATCAGGG - Exonic
1028818892 7:95182975-95182997 AAGCAGAGAAATGTTGTTCCTGG + Intronic
1030229758 7:107195329-107195351 AAGCTGTTAAATGTGGCTAAAGG - Intronic
1030957510 7:115873158-115873180 GAGCATTGAAATGTGGTTTTCGG - Intergenic
1031798663 7:126213564-126213586 ATCCTGTGAAATGTGGTTAAAGG - Intergenic
1032630836 7:133649657-133649679 AAGAAGTGGAATTGGGTTCAAGG + Intronic
1033031192 7:137828728-137828750 AAGCTGTGAAAAGAGCTTCAAGG - Intronic
1033039776 7:137907389-137907411 AAGGAGTGAAGTCAGGTTCAAGG + Intronic
1033257345 7:139813613-139813635 AAACAGTTACATGTGATTCAGGG - Intronic
1033778815 7:144645522-144645544 AGGCAGTAAAATGAGGGTCAAGG - Intronic
1034758328 7:153645244-153645266 AAGGAGTGCAATGTGGCTAATGG - Intergenic
1034959109 7:155353434-155353456 AAGCAGAGACATGTGGTTGGTGG - Intergenic
1035467819 7:159091177-159091199 AAGCATCGAATTGTGGTTTACGG + Intronic
1035665957 8:1379783-1379805 AAGCAGGGAAATGGGGTTGTTGG - Intergenic
1037966009 8:23134710-23134732 GGGCAGTGAAATTTGGGTCAGGG - Intergenic
1042351104 8:67778606-67778628 AGGAGGTGAAATGTTGTTCATGG + Intergenic
1043043412 8:75290916-75290938 AAACAGAAAAGTGTGGTTCAGGG + Intergenic
1043788735 8:84435801-84435823 AGGCATTGAACTGTGTTTCAGGG + Intronic
1043907906 8:85828972-85828994 TAGGAGTAAAATGAGGTTCATGG + Intergenic
1044373473 8:91442256-91442278 ATTGAGTAAAATGTGGTTCAGGG - Intergenic
1044397875 8:91734913-91734935 AAGAAGTCAAATGTGGCTCTAGG - Intergenic
1045525412 8:102937299-102937321 AAGAAGTAGAATGTGGTCCAAGG - Intronic
1045714725 8:105027827-105027849 AAGAAGAAAAATGTGGCTCAGGG - Intronic
1047991565 8:130291855-130291877 AAGCAGTGAAATGTAATAAATGG - Intronic
1050211800 9:3267833-3267855 AAACAGTAAAATTTTGTTCAAGG + Intronic
1051765145 9:20514856-20514878 AGGAAGTGAAATGTGTTTCCTGG + Intronic
1052212848 9:25927874-25927896 AAGGAGAGAAATGTGGGACAAGG + Intergenic
1054805258 9:69391371-69391393 AACCAGTTAAGTGTGGTTTACGG + Intronic
1056472262 9:86917593-86917615 AAGCAGAAAAATGTGGTGCCAGG + Intergenic
1060338594 9:122751665-122751687 AAGCACTGCAATGTGTTTGAGGG + Intergenic
1187065506 X:15833338-15833360 AAGCAGTAAAAGGTGTGTCAGGG - Intronic
1188350620 X:29126497-29126519 AGATAGTGCAATGTGGTTCATGG + Intronic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic
1189651405 X:43193575-43193597 AAGCAGTTAAATGAGGCACAAGG - Intergenic
1193427106 X:81352913-81352935 TAGCAGTTACATGTGTTTCAGGG - Intergenic
1193872809 X:86822657-86822679 AAACAGTGCATTGGGGTTCAGGG + Intronic
1195974503 X:110511581-110511603 AAGCAGTGACCTTTGGTTGAGGG - Intergenic
1197430042 X:126351029-126351051 AAGAAGAGAAAAGTGTTTCAAGG - Intergenic
1198571269 X:137959907-137959929 AAGCTGTGAAAGATGGTTCCTGG + Intergenic
1199056457 X:143301327-143301349 AAGCAGTAAAATTTTGTTCAGGG - Intergenic
1199211918 X:145222678-145222700 TAGGAGTGCAATGTGGATCAAGG - Intergenic
1199718796 X:150526979-150527001 AGGGAGGGAAATGTGGGTCAAGG + Intergenic
1200964156 Y:9021122-9021144 AAGCAGAGAAAAGTGGTATAGGG + Intergenic
1201289970 Y:12413664-12413686 AAGGAGAGAAGTGTGGCTCAGGG - Intergenic