ID: 1189126321

View in Genome Browser
Species Human (GRCh38)
Location X:38451161-38451183
Sequence TATTACTTAGAGGAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189126321 Original CRISPR TATTACTTAGAGGAGGGGGA AGG (reversed) Intronic
904199226 1:28808681-28808703 TATTTTTTTGAGGTGGGGGACGG - Intergenic
904949802 1:34227550-34227572 TATTAATTAGAACAGGTGGATGG + Intergenic
905279426 1:36839514-36839536 TATTCCTTGGAGGCTGGGGAGGG - Intronic
905583866 1:39102421-39102443 TATTAATTGGAGGCGGGGGGGGG + Intronic
906061176 1:42949644-42949666 TAGAACTGAGAGGAGGGGGCTGG + Intronic
906201423 1:43962934-43962956 TGTTAAATAAAGGAGGGGGAGGG + Intronic
906523600 1:46481161-46481183 ACTTACGGAGAGGAGGGGGAGGG + Intergenic
907403885 1:54241932-54241954 TACTCCTTAGAGGAGTGGGCTGG + Intronic
907779246 1:57550512-57550534 GATTAGTTAGAGAAGGGGGGTGG - Intronic
908615416 1:65915693-65915715 GTTTACAGAGAGGAGGGGGAGGG - Intronic
908671071 1:66548235-66548257 TATTTTTTTGAGGAGGAGGAGGG + Intronic
909203505 1:72724909-72724931 TATTACTTAGAGGAATGGAAGGG + Intergenic
909777557 1:79501500-79501522 TATAACATAGAGGAGGGGTCAGG - Intergenic
910784917 1:90986072-90986094 TATTACTTATATAAGTGGGAGGG + Intronic
911347444 1:96714115-96714137 TATCATTTTGAGGAAGGGGAAGG - Intergenic
911564387 1:99445676-99445698 TAAAACTTAGAGGAAGGGGGTGG + Intergenic
911681066 1:100716283-100716305 TAATAATTAGAGTAGGGGGCTGG - Intergenic
911923205 1:103793644-103793666 TATTACTTGGAGGGGGCAGAAGG - Intergenic
912134886 1:106648889-106648911 CCAAACTTAGAGGAGGGGGAAGG + Intergenic
913705023 1:121412529-121412551 TATTACTTTGACTAGGGTGATGG + Intergenic
914717240 1:150263251-150263273 TGTTACTTTGGGGAGTGGGAAGG - Intronic
915214599 1:154331391-154331413 AATTCCTTCGAGGCGGGGGAAGG + Intronic
915274578 1:154779383-154779405 TATAACTGAGTGGAGTGGGAAGG - Intronic
917014000 1:170508783-170508805 CATTACTTAGAGGGGGAGAAGGG - Intergenic
917709413 1:177669437-177669459 TATTACTCTGAGGCAGGGGAAGG - Intergenic
917799905 1:178560985-178561007 TAGTACTTGGATGGGGGGGATGG + Intergenic
919058422 1:192599929-192599951 TACCACTTAGAGGTGGGTGATGG - Intergenic
920295332 1:204952758-204952780 TGCTACTTTGAGGATGGGGATGG - Intronic
921712402 1:218386105-218386127 TAGTACTTAAAGGATGGGGTGGG - Intronic
1063436268 10:6034874-6034896 TTTTCCTTAGAAGAGGGGAAGGG + Intronic
1065302055 10:24331777-24331799 TATTAGGTAGAGGAGGGAGTTGG + Intronic
1071049835 10:81433297-81433319 TATTACTTAGAATAAAGGGAAGG - Intergenic
1071449274 10:85778951-85778973 TAATATTTAGAGGAGGATGAAGG + Intronic
1072205668 10:93203284-93203306 TATTGCTTATTGGAGGGGGTTGG + Intergenic
1073281273 10:102356067-102356089 TGTTACTAAGAGCTGGGGGAAGG + Intronic
1074890576 10:117733267-117733289 TAATCCATAGAGGTGGGGGAGGG - Intergenic
1075405336 10:122192062-122192084 AGTTAATTAGAGGAGGTGGATGG - Intronic
1075540742 10:123311627-123311649 TTTTACTTAGAGGAGAGGAAGGG - Intergenic
1075904926 10:126072786-126072808 TATTACTTAGAGAGGGAGCAGGG + Intronic
1077485296 11:2835747-2835769 AATTACTTAAAGGAGGGAAAGGG + Intronic
1077649052 11:3953038-3953060 GAATGCTTAGAGGAGGAGGAAGG + Intronic
1078939854 11:15990160-15990182 TATTCCTGAGAGGAGTGGAAAGG - Intronic
1079459129 11:20664448-20664470 TATTCTTTAGAGCAGAGGGAAGG + Intergenic
1080035531 11:27706105-27706127 TGGCACTTAGAGGCGGGGGAGGG + Intronic
1080566308 11:33512714-33512736 TATTACCTAGAGCAGGGGCCGGG - Intergenic
1081010413 11:37804292-37804314 TATTTTTTGGGGGAGGGGGAGGG + Intergenic
1081172639 11:39887775-39887797 TATTTTGTAGGGGAGGGGGAGGG + Intergenic
1082083509 11:48030438-48030460 TATGACTCAGACAAGGGGGATGG - Intronic
1085227575 11:74936279-74936301 TATTACTTAGTGCCGGGGGCAGG - Intronic
1086938709 11:92772122-92772144 TATTATTTGGAGGTGGGGGAAGG - Intronic
1087757953 11:102074202-102074224 TAGGACTTGGAGGTGGGGGAGGG + Intronic
1088248240 11:107840011-107840033 TATTGCCTAGATTAGGGGGAAGG + Intronic
1088522998 11:110719421-110719443 TATTGCTTAGAGGAAGGCAAGGG - Intergenic
1089452427 11:118607683-118607705 TCTTACCTAGAGGTGGGGGGGGG - Intronic
1090402809 11:126459756-126459778 TATTACATGGAGGAGAGGGTGGG + Intronic
1090925139 11:131242976-131242998 TCTCAGTTAGAGGAGGGGAAGGG - Intergenic
1092774497 12:11930679-11930701 TATTACCTTGAGAAGGGGTAAGG - Intergenic
1092972182 12:13706903-13706925 TGTTCCTGAGAGGAGGAGGAAGG - Intronic
1093153802 12:15655890-15655912 TTTTACTTGGACGAGGGAGATGG - Intronic
1093247989 12:16763677-16763699 TATTATTTAGAAGAGAAGGAAGG - Intergenic
1093709346 12:22312131-22312153 GTTTATTTAGAGGAGAGGGAGGG - Intronic
1097463184 12:59888981-59889003 TATTACTTGGAAAAGGGAGATGG + Intergenic
1098523226 12:71457287-71457309 TATTTCTGAGAGAAAGGGGATGG + Intronic
1099237266 12:80096340-80096362 TATCACTTTGAAGAGAGGGATGG + Intergenic
1101541954 12:105673379-105673401 TAGTACTTAGAGTAGGAAGAAGG + Intergenic
1101646989 12:106640657-106640679 TAATACTTAGAGAAGGGTGAAGG - Intronic
1102121518 12:110445653-110445675 GATTAATTAGGGGAGGGAGAAGG + Intronic
1102808887 12:115806793-115806815 TTTTCCTTTGGGGAGGGGGAAGG - Intergenic
1102866929 12:116382066-116382088 CATTTCCTACAGGAGGGGGACGG - Intergenic
1107040932 13:35946292-35946314 AATGACTTAGAGGATGGGCATGG - Intronic
1110344962 13:74435472-74435494 TATTAGATAGAAGAAGGGGAGGG - Intergenic
1110898411 13:80787078-80787100 TAGTACCTGGATGAGGGGGAGGG + Intergenic
1112336624 13:98522143-98522165 AGTTACCCAGAGGAGGGGGAGGG - Intronic
1112464196 13:99629391-99629413 TAAAACCTGGAGGAGGGGGAAGG - Intronic
1112480316 13:99769200-99769222 TGTGACTGAGAGGTGGGGGATGG + Intronic
1113118788 13:106904170-106904192 AATTACTTAGAGAAGGGATATGG + Intergenic
1114528049 14:23378536-23378558 CATCATTTAGAGGAGAGGGAAGG - Intronic
1116840103 14:49811514-49811536 TATTACTGATGGGAGGAGGAAGG + Intronic
1118948147 14:70408109-70408131 TTTTTTTTGGAGGAGGGGGAAGG + Intronic
1119019988 14:71101759-71101781 TAGAACTTAGAGGAGAGGGTTGG + Intronic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120868072 14:89312521-89312543 TATAACTTGGAGAAGGGGTAGGG + Intronic
1120958176 14:90101377-90101399 CAATACTTAGACGAGGGGGCAGG + Intronic
1121102190 14:91257514-91257536 TCATCCTTAGAGTAGGGGGATGG - Intergenic
1122753618 14:103958943-103958965 TAATACTCAGAGCAGTGGGAAGG + Intronic
1202884432 14_KI270722v1_random:90942-90964 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1125796491 15:42407637-42407659 TATTTCTTATATGAGGGGCAGGG + Intronic
1126306185 15:47260725-47260747 TATTTCTTGGAGGGGAGGGATGG + Intronic
1126676326 15:51161910-51161932 TATCAGCAAGAGGAGGGGGAAGG - Intergenic
1127704110 15:61530399-61530421 TATCACTTTTGGGAGGGGGAAGG - Intergenic
1129182758 15:73887346-73887368 CATTAGATAGAGGAAGGGGAGGG - Intronic
1130287168 15:82565658-82565680 GATGGATTAGAGGAGGGGGAGGG + Intronic
1130373408 15:83306431-83306453 TCCTACTTTGAGGTGGGGGAGGG - Intergenic
1131908567 15:97171020-97171042 TATTACATACAACAGGGGGATGG + Intergenic
1134330671 16:13248359-13248381 TATTTTTTGGAGAAGGGGGAAGG - Intergenic
1134456969 16:14401980-14402002 TAGTTCATAGAGGAGGGGCAGGG - Intergenic
1136031830 16:27508816-27508838 TATTACTCAGAGGCTTGGGAGGG - Intronic
1136296593 16:29307537-29307559 TAGTACTTAGAGGAGTGAGGTGG + Intergenic
1138389935 16:56662930-56662952 TTATAGTTAGAGGAGGGGGCCGG + Intronic
1140685723 16:77432753-77432775 TTTTTATTGGAGGAGGGGGAAGG - Intronic
1141175239 16:81714176-81714198 TTTTACTTGGAGGTGGGGGATGG - Intergenic
1141238513 16:82242902-82242924 TATGAAGTAGAGAAGGGGGATGG + Intergenic
1142008150 16:87700172-87700194 CATGACCTAGAGGAGGGAGACGG - Intronic
1142058215 16:88013848-88013870 TAGTACTTAGAGGAGTGAGGTGG + Intronic
1144210302 17:13008792-13008814 AATTAATTAGAAGAGGGGAAAGG + Intronic
1144527849 17:16005820-16005842 TATTACTTTGAACAGGGGTAAGG + Intronic
1145922865 17:28624153-28624175 TCATATTTAGAGGTGGGGGAAGG + Intronic
1147150898 17:38513058-38513080 TATATAATAGAGGAGGGGGAGGG - Intergenic
1148507687 17:48141087-48141109 GATTGATTAGAAGAGGGGGATGG - Intronic
1148823055 17:50371883-50371905 ATTTACTTTGAGGAGGAGGATGG - Intronic
1149781387 17:59399242-59399264 TATTTCCTTGAGGAGGGGGAAGG - Exonic
1156403466 18:36761076-36761098 TATTTCTAAAAGCAGGGGGAAGG - Intronic
1156717853 18:40033163-40033185 TCTTGCTTAAAGGAGGGAGAAGG + Intergenic
1156802206 18:41129757-41129779 TCTTAATTTGAGGAGGAGGATGG + Intergenic
1157195944 18:45620136-45620158 TATTCCCTAGAGGAGGTGCAAGG + Intronic
1158565012 18:58547452-58547474 TAATGCCTAGAGGAGGGAGAAGG - Intronic
1160416976 18:78718345-78718367 TATTACATAAAGGAGTGTGAGGG + Intergenic
1162199270 19:9009143-9009165 ATTTACTCAGAGGAGGAGGAAGG - Intergenic
1164229390 19:23274335-23274357 TAATGCTGAGAGGAGGGGGTTGG - Intergenic
1164593441 19:29518764-29518786 TGTTACTAAGAGGAGAGGAATGG - Intergenic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1167129006 19:47572521-47572543 AGTTACTTAAAGGAGGGGGAGGG + Intergenic
1167584272 19:50364634-50364656 AAGTCCTGAGAGGAGGGGGAGGG + Intronic
1202659840 1_KI270708v1_random:58071-58093 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
930429785 2:51260202-51260224 TAATACTTATTGGAGGGGGCAGG + Intergenic
930545145 2:52758194-52758216 TTTTACTTTGAGCAGGGGAAAGG - Intergenic
932408965 2:71534060-71534082 TTTTACAGGGAGGAGGGGGAAGG + Intronic
932783146 2:74576063-74576085 TAGTACTTAGAGAAATGGGAGGG + Intronic
934606650 2:95700328-95700350 TATTATTTAGAGGAGAGAGAGGG - Intergenic
935505263 2:103892440-103892462 TATGAATTGGAGGAGGGGGAGGG + Intergenic
936036859 2:109120207-109120229 CATTTGTAAGAGGAGGGGGAGGG + Intergenic
936776812 2:115984424-115984446 TATTTCCTAGAGGAAGGAGAGGG - Intergenic
937475933 2:122215234-122215256 TATTAGAGAGAGGAGGAGGAGGG + Intergenic
941941225 2:171040478-171040500 TATTTTTTAGAGGAGGAGGAGGG - Intronic
942505603 2:176638230-176638252 TATTATTTGGAGGTGGGCGAGGG + Intergenic
942784753 2:179688181-179688203 TATGAGTTAGAGGTGGGGAAGGG + Intronic
948305944 2:236946846-236946868 TATTACTAGGAGAAGTGGGAAGG + Intergenic
948395776 2:237643959-237643981 TATTACATGAAGGAGGGGTAAGG - Intronic
948496516 2:238353406-238353428 CCATCCTTAGAGGAGGGGGAGGG + Intronic
1169373869 20:5050392-5050414 TTATTCTTAGAGAAGGGGGAAGG - Intergenic
1171085834 20:22237451-22237473 TATTAAAAAGAGGAAGGGGAAGG - Intergenic
1172165772 20:32898226-32898248 TGTGAGTTAGAGGATGGGGAAGG - Intronic
1172557192 20:35852514-35852536 AAATACTTAGAGGGAGGGGAAGG + Intronic
1173004447 20:39128973-39128995 TGTTACTGAGAAGAGGGGGCAGG - Intergenic
1177814242 21:25958785-25958807 TATTACTTAGAGGAAAGAAAGGG - Intronic
1178539257 21:33435556-33435578 GATTACTGAGATGAGGGGTAAGG + Intronic
1180327314 22:11441633-11441655 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1181571334 22:23769205-23769227 TATTACTCCTAGGTGGGGGAAGG + Intronic
1182036552 22:27202986-27203008 AATTACGCCGAGGAGGGGGAGGG - Intergenic
1182453377 22:30434275-30434297 TCTTACCTAGAGGTGAGGGATGG - Intergenic
1182791067 22:32953517-32953539 TATTAATAAGGGGCGGGGGAGGG + Intronic
1182941309 22:34280211-34280233 TTTTATTCAGAGGAGGGGGATGG - Intergenic
1185186266 22:49402339-49402361 CATTACCTGGAGGAGGAGGAAGG - Intergenic
949964166 3:9341204-9341226 TATTAATTTGAGGAGGGGAGAGG + Intronic
950011557 3:9727743-9727765 TTTTACATAGAGGAGTGAGATGG + Intronic
950334307 3:12181468-12181490 TATGACATAAAGGAGGGAGAAGG + Intronic
950554410 3:13686487-13686509 TGTTCCTTAGAGGAGGGGTATGG + Intergenic
954831742 3:53426889-53426911 TATCACTTGGAGGTGGGGGGTGG - Intergenic
955548291 3:60055776-60055798 TAGCACTTAGAGGAACGGGAAGG + Intronic
955772018 3:62394731-62394753 TAAGACTCAGAGGAGGGAGAAGG - Intergenic
956498058 3:69850113-69850135 TATTACTTATGGGAGGGTGGGGG - Intronic
957160674 3:76605638-76605660 AATTGCTTAGAGGAGGGAGCTGG + Intronic
957170883 3:76735428-76735450 GATTATTTAGAGGGGGAGGAAGG + Intronic
957717804 3:83953730-83953752 AGTTACTTAGAGGTGGGAGATGG + Intergenic
957939659 3:86990054-86990076 TGTGACTTAGAGGACAGGGATGG - Intronic
960973458 3:123155258-123155280 ACTTACTTGGAGGAGAGGGATGG + Intronic
962024728 3:131536002-131536024 TAATACATAGAGAAGGGGTAGGG + Intronic
962202046 3:133408860-133408882 TGTTACTTATAGGAGGGTGGAGG + Intronic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
967446661 3:189574778-189574800 TGTTACTGAGATGAGGGGTAGGG + Intergenic
968240442 3:197077847-197077869 TATTATTTTTTGGAGGGGGAAGG + Intronic
969996576 4:11318654-11318676 TTTTACTTAGAAGATAGGGATGG + Intergenic
971085729 4:23273077-23273099 TATCAGATAGAGGTGGGGGATGG + Intergenic
973301379 4:48588745-48588767 TATTACTTACAGGTGGGTGGGGG - Intronic
975704687 4:77099979-77100001 TAGTATTCAGAGCAGGGGGATGG + Intergenic
976072974 4:81262819-81262841 TATTAAATAGAGGAGGAGGTTGG + Intergenic
976403065 4:84629679-84629701 TCTGACTTAGAGGAAGGGGGAGG - Intronic
977346742 4:95825292-95825314 TGTTACTAAGAAGAGGGAGAGGG - Intergenic
978044517 4:104109981-104110003 CATAACTTTGAGGTGGGGGAAGG - Intergenic
982148264 4:152422755-152422777 AGTTACTTAGAGGAAGGGAAGGG - Intronic
982588133 4:157269131-157269153 TATTAATTAAAGGAGGGGTGAGG - Intronic
989472058 5:41831671-41831693 AATCAATTAGAGGAGGGAGAAGG + Intronic
989973753 5:50556372-50556394 TATTACTTTGACTAGGGTGATGG - Intergenic
990749978 5:59003952-59003974 TTTTTTTTAAAGGAGGGGGAAGG - Intronic
992024362 5:72655983-72656005 TATTTCTTGGAGGGGAGGGAGGG - Intergenic
995736988 5:115312059-115312081 TATAAATTAGAGTAGTGGGAAGG + Intergenic
996116829 5:119629257-119629279 CATTGCTCAGAGGAGGGGTATGG - Intronic
996379246 5:122846602-122846624 TAATATTTAGAGGAGGGGAGAGG - Intronic
999257159 5:150216120-150216142 TAGGACTTAGAGGCAGGGGAGGG + Intronic
1000254598 5:159525769-159525791 TATCACCTAGAGAAGGAGGAGGG - Intergenic
1001109520 5:168883989-168884011 TGTTGCTTTGAGGAGGGTGAGGG + Intronic
1001126870 5:169027631-169027653 TATTACATTCAGGAGGGGGAAGG - Intronic
1001218870 5:169882184-169882206 GCTTGCTAAGAGGAGGGGGATGG + Intronic
1001503861 5:172261121-172261143 TCTCACTTAGAAGCGGGGGAGGG - Intronic
1003284115 6:4719414-4719436 AAGTACTTAGAGGGGAGGGAAGG - Intronic
1003974136 6:11326782-11326804 TGTTCCTGAGTGGAGGGGGAAGG - Intronic
1007660345 6:43481168-43481190 TATTTCTGAGAGGAAGGAGAGGG - Intronic
1008541846 6:52552429-52552451 TATTACTAAGAGGAAGCAGAAGG + Intronic
1009319911 6:62274792-62274814 ATTTAGTTTGAGGAGGGGGAAGG - Intronic
1009756476 6:67946868-67946890 TATAACTATGAGGAGGGGGAAGG - Intergenic
1010786940 6:80014274-80014296 TATTAATTAGAGAAATGGGAAGG - Intronic
1012994330 6:105958328-105958350 TGTTACTTTGAGGATTGGGAGGG - Intergenic
1013557254 6:111269202-111269224 TATTTATTAGGGGTGGGGGATGG + Exonic
1016812511 6:148274921-148274943 TGTAAATTAGAGGAGGGGCAGGG - Intronic
1019817438 7:3211457-3211479 TATTACAAGGGGGAGGGGGATGG + Intergenic
1021688842 7:23213054-23213076 TATGAGGAAGAGGAGGGGGAGGG + Intergenic
1022820723 7:33957995-33958017 AATTACTTTGAGGAGACGGAGGG + Intronic
1023441566 7:40190082-40190104 TCTTTCTTAGAGGAGCTGGAAGG + Intronic
1026300443 7:69093085-69093107 TAATAATTTGAGGAGGAGGAAGG - Intergenic
1028723552 7:94060979-94061001 TGTTAGTGAGAGGAGTGGGAGGG - Intergenic
1033938843 7:146625217-146625239 TATTAATTAGAAGATGGGGGAGG + Intronic
1034527459 7:151674654-151674676 CATTTCATAGAGGAGTGGGATGG - Intronic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1034673051 7:152871948-152871970 AGTTACCAAGAGGAGGGGGATGG + Intergenic
1035037704 7:155906247-155906269 TATTAAAGAGAGGAAGGGGAGGG + Intergenic
1037081033 8:14786914-14786936 GATAAATTAGAGGAGGGGAAAGG + Intronic
1038537862 8:28367307-28367329 TATTACTTAGAGTAATAGGAAGG - Intronic
1040459442 8:47633392-47633414 TCTTCTTTATAGGAGGGGGATGG + Intronic
1040513831 8:48118346-48118368 TATTAATATGAGGAGGGGAAGGG + Intergenic
1040621415 8:49096523-49096545 GATTCCTTAGAGGAGGGGAATGG - Intergenic
1041549477 8:59083652-59083674 TATTTATTACAGGAGGAGGAGGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046597749 8:116281315-116281337 TTTTATTTATAAGAGGGGGAAGG - Intergenic
1046853401 8:119001379-119001401 TATAAATTGGAGGAGGGTGAAGG + Intronic
1047696099 8:127405185-127405207 TATGAATTAGAGGAGGGAGATGG + Intergenic
1048908114 8:139107889-139107911 TATTTCTTAGGTGAGGGGCAAGG - Intergenic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1049918715 9:343722-343744 TATTCCTTAGAGGAAGATGAAGG + Intronic
1050182570 9:2936071-2936093 TCTTATTTGGAGTAGGGGGATGG - Intergenic
1050702618 9:8357928-8357950 TGTTACTTAGGGGAAAGGGAGGG - Intronic
1051044442 9:12856512-12856534 TGTTGCTTAGAGAAGGGGGTGGG + Intergenic
1051790235 9:20793890-20793912 TCTTATTTAGTGGAGAGGGAAGG + Intronic
1052772634 9:32703657-32703679 GAGTACTTAAAGGAGGAGGAGGG - Intergenic
1059127127 9:111700366-111700388 TGTTACTTTGACCAGGGGGATGG - Intronic
1062362759 9:136195457-136195479 TATTTCTCAGTGGACGGGGAGGG - Intergenic
1186496026 X:10013964-10013986 TATTACTTTTATGAGGGGAAAGG - Intergenic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1187835739 X:23430301-23430323 AATAACTCAGGGGAGGGGGATGG + Intergenic
1189126321 X:38451161-38451183 TATTACTTAGAGGAGGGGGAAGG - Intronic
1191112897 X:56821709-56821731 TGCTACTTAGAGTTGGGGGAGGG - Intergenic
1191991291 X:67039404-67039426 TGTTACCTAGAGTTGGGGGAGGG + Intergenic
1192379894 X:70604649-70604671 TATTACTTGGAGAGGAGGGAAGG + Intronic
1194807481 X:98347407-98347429 GATTACTTAGAGGTGGGGATGGG + Intergenic
1194909335 X:99620487-99620509 TAGTAGTTAGAGAATGGGGAAGG + Intergenic
1195483627 X:105376357-105376379 TATTTCTTACAGGAGGAAGAGGG - Intronic
1199057517 X:143315826-143315848 CATTACTTAGAGAAGGAGCAAGG + Intergenic
1199851149 X:151725585-151725607 TCTTACTTGGGGGTGGGGGAGGG + Intergenic
1200869797 Y:8085142-8085164 TCTTACTGAGAGGAGGGGCCAGG + Intergenic
1202350058 Y:23980108-23980130 CCTCACTTAGAGGATGGGGATGG + Intergenic
1202350900 Y:23989914-23989936 TATGACTGAGAAGAGTGGGAGGG - Intergenic
1202519879 Y:25680205-25680227 TATGACTGAGAAGAGTGGGAGGG + Intergenic
1202520721 Y:25690013-25690035 CCTCACTTAGAGGATGGGGATGG - Intergenic