ID: 1189128906

View in Genome Browser
Species Human (GRCh38)
Location X:38478338-38478360
Sequence TATCCAAGGCTACCACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189128905_1189128906 -10 Left 1189128905 X:38478325-38478347 CCTCACTCTGGTATATCCAAGGC 0: 1
1: 0
2: 2
3: 6
4: 98
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117
1189128899_1189128906 8 Left 1189128899 X:38478307-38478329 CCAATTCAGTCCCTGCTCCCTCA 0: 1
1: 0
2: 2
3: 38
4: 312
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117
1189128898_1189128906 26 Left 1189128898 X:38478289-38478311 CCTAGAATTCTGATTGTGCCAAT 0: 1
1: 0
2: 1
3: 24
4: 201
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117
1189128902_1189128906 -3 Left 1189128902 X:38478318-38478340 CCTGCTCCCTCACTCTGGTATAT 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117
1189128903_1189128906 -9 Left 1189128903 X:38478324-38478346 CCCTCACTCTGGTATATCCAAGG 0: 1
1: 0
2: 2
3: 6
4: 107
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117
1189128901_1189128906 -2 Left 1189128901 X:38478317-38478339 CCCTGCTCCCTCACTCTGGTATA 0: 1
1: 0
2: 3
3: 16
4: 160
Right 1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG 0: 1
1: 0
2: 2
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189128906 Original CRISPR TATCCAAGGCTACCACAAAG TGG Intronic
902152691 1:14457139-14457161 TGTCCAAGGCTTCCACAAAGTGG + Intergenic
907304987 1:53508418-53508440 TTTCCAGGGCTCCAACAAAGGGG - Intronic
910483005 1:87678902-87678924 TCTCCAAGGAAGCCACAAAGTGG + Intergenic
913347044 1:117819495-117819517 TAGCTAAGTCCACCACAAAGTGG + Intergenic
918019212 1:180668435-180668457 AATCCAAGGGTAACAGAAAGAGG - Intronic
919669310 1:200324420-200324442 TCTCCAAGGCTACGACATGGTGG - Intergenic
920838343 1:209532896-209532918 TTTCCTAGGGTACCACAAATTGG + Intergenic
921269118 1:213451530-213451552 TCTCCTAGGCTCCCACACAGTGG + Intergenic
1063514841 10:6685581-6685603 TGTCCAAGGCTAGAACTAAGAGG + Intergenic
1063812867 10:9734198-9734220 GGTCCAAGGCTGCTACAAAGAGG + Intergenic
1064629127 10:17291503-17291525 TATCCAAAGCTGCTAAAAAGAGG - Intergenic
1067513750 10:46918416-46918438 AATCCAAGGCAAGCAAAAAGAGG - Intronic
1067648503 10:48133418-48133440 AATCCAAGGCAAGCAAAAAGAGG + Intergenic
1068243291 10:54333995-54334017 TATCCACGACTATCAGAAAGGGG - Intronic
1068569851 10:58616722-58616744 TGGCCAAGTCCACCACAAAGTGG - Intronic
1073957429 10:108889566-108889588 TATCCAAGGGTAAGAGAAAGGGG + Intergenic
1078059522 11:8034149-8034171 TATCCAAGGGTCCCAGACAGAGG + Intronic
1081769408 11:45639017-45639039 TATCCAAATTTAGCACAAAGAGG + Intergenic
1083697729 11:64453802-64453824 TCTCCAGGGCTGCCACAAGGGGG + Intergenic
1085181676 11:74541785-74541807 TAGCCAAGTCCACCACACAGTGG - Intronic
1085644476 11:78214216-78214238 GATCCAAGCCTTGCACAAAGGGG + Exonic
1087322749 11:96683405-96683427 TTTTCAAGGCTACCACAAATGGG - Intergenic
1087541429 11:99526319-99526341 TATCAAAGGAGACCACACAGTGG - Intronic
1094268347 12:28584190-28584212 CATCTAATGCAACCACAAAGTGG + Intergenic
1097297798 12:57985693-57985715 ATGCCAAGGCTAGCACAAAGAGG - Intergenic
1099580170 12:84435996-84436018 TAGCCAAGGCTCCCACTGAGAGG - Intergenic
1102183120 12:110927814-110927836 TCTCCAAGGCCACCATAGAGTGG - Intergenic
1103412389 12:120721680-120721702 AATCCAAGGCCAGCACACAGGGG - Exonic
1103731816 12:123032913-123032935 CAGCCAAGGCTCCCACATAGGGG + Intronic
1106500254 13:30321580-30321602 TATCCAAGGCTACTCCAATGAGG - Intergenic
1107371249 13:39751784-39751806 CATCGAAGGCTCCCACAGAGTGG - Exonic
1112287230 13:98114776-98114798 TTTTAAATGCTACCACAAAGTGG - Intergenic
1117877325 14:60267152-60267174 AAGCCAAGGCTAACAAAAAGAGG - Intronic
1140549861 16:75854108-75854130 TAACAAAGTCTACCACACAGTGG + Intergenic
1143166126 17:4897999-4898021 TATCCAAGGCCACTACATTGAGG - Exonic
1151043541 17:70893356-70893378 TGTCCAAGGCTTCCAGACAGAGG - Intergenic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1152397095 17:80040129-80040151 TCTCCAAGGCTTCCAGCAAGAGG + Exonic
1155183857 18:23370988-23371010 TTTCCAAGGTCACCAAAAAGTGG + Intronic
1159352873 18:67298520-67298542 TAGCCAAGTCCACCACATAGTGG - Intergenic
1159412835 18:68104346-68104368 TATTTAAGGCTACCACAACAGGG + Intergenic
1160126188 18:76174566-76174588 TCTCCAAGGATACTACAAAAAGG - Intergenic
1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG + Intergenic
1162790475 19:13060282-13060304 CATCCAAGGCTTCCTCAGAGTGG - Intronic
1164576993 19:29411253-29411275 TATCAAAGGAGACAACAAAGAGG + Intergenic
1165006348 19:32810706-32810728 AATTCAAGGCTATCACCAAGTGG - Intronic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
1167525935 19:49983814-49983836 TAACCAAGGGGACCACAAGGGGG - Intronic
1168423344 19:56219448-56219470 CATCCAAGACTCCCATAAAGGGG + Intergenic
1168713529 19:58514604-58514626 TATCCCAGGATAACAGAAAGGGG - Intronic
925307060 2:2855785-2855807 CATCCAAGCCAACCACGAAGGGG + Intergenic
929162722 2:38849070-38849092 TATCTATGTGTACCACAAAGAGG + Intronic
930576273 2:53153280-53153302 TCTCCAATGCTAGCACAAATAGG + Intergenic
933530370 2:83502099-83502121 AATCTAATGCTACCTCAAAGTGG + Intergenic
934692142 2:96370101-96370123 TACCCAGGGATACCACAGAGAGG + Intronic
935077307 2:99757644-99757666 TATCCTGGGCTACCTCTAAGTGG + Intronic
935540091 2:104338456-104338478 TATGCAAGGCTCCCACAATCTGG - Intergenic
939167480 2:138654827-138654849 TGTCCAGGGCTAAAACAAAGAGG - Intergenic
940133084 2:150406360-150406382 TAACCCAGGCTACCCTAAAGAGG - Intergenic
946362161 2:219225544-219225566 TAGTGAAGGCAACCACAAAGAGG + Exonic
947442849 2:230138343-230138365 TCTCCCAGGCTGCCACACAGTGG + Intergenic
1170866879 20:20165426-20165448 AATCCAGGGCTACAGCAAAGAGG + Intronic
1176673422 21:9754907-9754929 TATCCAGGCCCACCACACAGTGG + Intergenic
1178750615 21:35299220-35299242 TATCCCAGAGTACCACAAACTGG - Intronic
1179148055 21:38786235-38786257 AGTCCGAGACTACCACAAAGTGG + Intergenic
1181890527 22:26059117-26059139 TGTCCAAGTCTACCTCATAGTGG - Intergenic
1182639423 22:31754388-31754410 TGAGCAAGGCAACCACAAAGAGG - Intronic
952524248 3:34193506-34193528 TAACCAAGGCCACTACTAAGTGG - Intergenic
957221613 3:77389899-77389921 TAGCCTAGGCTTCCACACAGTGG - Intronic
957729203 3:84110657-84110679 TATTCAAGGCTACCACAAAAGGG - Intergenic
961906084 3:130264315-130264337 GACCCAAGGCCAGCACAAAGAGG - Intergenic
963857840 3:150273976-150273998 TATCCAATTCTACCACCAAATGG + Intergenic
965239314 3:166174303-166174325 TAGCCTAAGCTACCACAAAAGGG - Intergenic
970176446 4:13344469-13344491 CAACCTAGGCTACCACCAAGTGG + Intergenic
971025340 4:22584015-22584037 AATCTGAGGCTGCCACAAAGTGG - Intergenic
971163355 4:24157022-24157044 TATTCAAGGATACCACATAGAGG + Intergenic
974793947 4:66724615-66724637 TATCCACGGCTGCTAAAAAGTGG + Intergenic
975762743 4:77634643-77634665 TAGCTAAGTCCACCACAAAGTGG + Intergenic
976748839 4:88433401-88433423 TTTTCAAGGCTACCACATTGGGG - Intronic
981400715 4:144310761-144310783 CATTCAAGGCTACTACTAAGGGG - Intergenic
982425120 4:155249075-155249097 GATCTAAGGCAACCAAAAAGTGG + Intergenic
984922352 4:184776913-184776935 TTTCCAAGGGTATCATAAAGTGG + Exonic
985139034 4:186820390-186820412 CATCCATGGCCCCCACAAAGCGG - Intergenic
986168554 5:5296726-5296748 TGTCCAACGATAGCACAAAGGGG - Intronic
987507632 5:18793714-18793736 TATGCAAGTCCACCACAGAGTGG - Intergenic
988239476 5:28591120-28591142 TATCCACCGATACCACACAGAGG + Intergenic
992362106 5:76049360-76049382 TATCCAAGGCTACTATGCAGTGG + Intergenic
993434232 5:87871877-87871899 TTTCAAAGCCTACCTCAAAGTGG + Intergenic
1005105617 6:22221367-22221389 TATCAAAGTCTTCTACAAAGTGG - Intergenic
1007653063 6:43434990-43435012 TATCCAAGGCCCCCACAAAAAGG - Intronic
1008855201 6:56076260-56076282 TATCCATGGCTACCAGCAAAAGG + Intronic
1010184217 6:73124189-73124211 TATCCATGGCTAAGAAAAAGTGG - Intronic
1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG + Intergenic
1013622376 6:111902393-111902415 AATGCAAGGGTAACACAAAGTGG - Intergenic
1023811031 7:43912167-43912189 TATCCAAAGCTAGCAAAAGGAGG + Intronic
1024229820 7:47355327-47355349 TATCCAAAGCCACCACAACAGGG + Intronic
1026834111 7:73626862-73626884 TTTCCAAGGCTGCCACACATGGG - Intergenic
1027454036 7:78365159-78365181 TGTCCAGGGCTACTCCAAAGTGG + Intronic
1030894311 7:115038409-115038431 TATAAAAGGCAACCACAAACAGG + Intergenic
1031687801 7:124753526-124753548 TATGAAAGTCTACCACAAAGTGG + Intronic
1032968576 7:137131669-137131691 AATCCAAGGTGACTACAAAGTGG + Intergenic
1033483732 7:141767355-141767377 TTTTCAAGGCTGCCACAAAAGGG - Intronic
1039588424 8:38726962-38726984 TGTCAAATGCTACCACAAATTGG - Intergenic
1039771383 8:40691005-40691027 AATCCAAGGCTCTCACTAAGTGG - Intronic
1041354215 8:56983049-56983071 TATCCCAGGCAACCACTAATCGG - Intronic
1045176045 8:99725829-99725851 TATTCAATGATATCACAAAGAGG - Intronic
1048179533 8:132182406-132182428 TATCCAATTCTTCCACAATGTGG - Intronic
1048453932 8:134560376-134560398 TATATAAGGTTAGCACAAAGAGG + Intronic
1049060283 8:140271393-140271415 CATCCAAAGCCACCACTAAGAGG + Intronic
1050049387 9:1583354-1583376 TTTTCAAGGCTACCACAGATGGG + Intergenic
1051188941 9:14490760-14490782 TATCCAACGCTACCACGCACTGG + Intergenic
1052569268 9:30199572-30199594 TAGCCAAGTCCACCACATAGTGG - Intergenic
1055336561 9:75238168-75238190 TCGCCAAGTCTACCACATAGTGG + Intergenic
1057688597 9:97262003-97262025 TATGCAAGGACACCACATAGGGG - Intergenic
1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG + Intergenic
1187956940 X:24528479-24528501 CTTCCAAGGGTAGCACAAAGTGG - Intronic
1188263055 X:28040323-28040345 TTCCCCAGGGTACCACAAAGAGG + Intergenic
1189128906 X:38478338-38478360 TATCCAAGGCTACCACAAAGTGG + Intronic
1190469876 X:50768220-50768242 TATCCAAGTCTTTCACAAAAAGG - Intronic
1192302021 X:69915192-69915214 TATGAAAGGCTACAACAAATGGG - Intronic
1193021651 X:76799000-76799022 TAGCTAAGTCCACCACAAAGTGG - Intergenic
1196882046 X:120207421-120207443 TAGCCAAGTCCACCACACAGTGG - Intergenic
1199552697 X:149076070-149076092 TAGCCAAGTCTACAACATAGTGG - Intergenic
1202173158 Y:22072481-22072503 TTTCCAAGGCTACCACCAGAGGG - Exonic
1202218202 Y:22513890-22513912 TTTCCAAGGCTACCACCAGAGGG + Exonic
1202324984 Y:23682165-23682187 TTTCCAAGGCTACCACCAGAGGG - Intergenic
1202545787 Y:25987889-25987911 TTTCCAAGGCTACCACCAGAGGG + Intergenic