ID: 1189129117

View in Genome Browser
Species Human (GRCh38)
Location X:38480064-38480086
Sequence GCGCCCTACTCAAGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189129117_1189129118 6 Left 1189129117 X:38480064-38480086 CCTTGTGATCTTGAGTAGGGCGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1189129118 X:38480093-38480115 GTTTTCTCATTGTGTCTCTGTGG 0: 1
1: 0
2: 9
3: 42
4: 461
1189129117_1189129119 14 Left 1189129117 X:38480064-38480086 CCTTGTGATCTTGAGTAGGGCGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1189129119 X:38480101-38480123 ATTGTGTCTCTGTGGCTGTGTGG 0: 1
1: 0
2: 4
3: 47
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189129117 Original CRISPR GCGCCCTACTCAAGATCACA AGG (reversed) Intronic
900487503 1:2930437-2930459 GCGCCCTTCTCTAGTTCAAAAGG + Intergenic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG + Intergenic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
915521165 1:156445102-156445124 GCACCCTACTGAGGTTCACAGGG + Intergenic
918472068 1:184885005-184885027 GCCTCCTACCCAACATCACAGGG + Intronic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
922579704 1:226687813-226687835 GCTCTCTACTCAAGACCATAGGG + Intronic
1064676566 10:17765792-17765814 GCGCCCAACTTAAAACCACAGGG - Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067324474 10:45253818-45253840 GCTCCCAACTCAAGAACCCAGGG - Intergenic
1074336596 10:112582502-112582524 GAGCCCTTCTCCAGATCTCATGG + Intronic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079209639 11:18449767-18449789 GGGCTCTACTCAGGAGCACAAGG - Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1084331512 11:68433162-68433184 GCGCCCTCCTCAGGACCAGAGGG - Intronic
1089490103 11:118877622-118877644 GCTCCCTCCACAAGACCACACGG - Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1096437264 12:51604434-51604456 GCGCCTTCCTCAATACCACACGG + Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1110108243 13:71707873-71707895 GAGCCATACTCAAGGGCACATGG + Intronic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1123162086 14:106288091-106288113 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1123180127 14:106461495-106461517 GCCCCCTCCTCAGGATTACAGGG - Intergenic
1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG + Intronic
1134567921 16:15266847-15266869 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG + Intergenic
1134932952 16:18222400-18222422 ACGCCCTACCCAAGGTCGCATGG - Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1159093832 18:63879432-63879454 GCGACCTACCTAAGATTACATGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG + Intergenic
934615349 2:95767298-95767320 GCGCCTTGTTCAAGATCATAGGG + Intergenic
934838960 2:97613350-97613372 GCGCCTTGTTCAAGATCATAGGG - Intergenic
941329794 2:164165670-164165692 GCCACCGACTCAAGGTCACAGGG + Intergenic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
945049572 2:205810362-205810384 GAGGCCTACTGAAGTTCACAGGG - Intergenic
945188819 2:207166148-207166170 ACGCCCTCCTCGAGATCCCACGG - Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
948902798 2:240964758-240964780 ACGCCCTGCTCAGGCTCACAGGG + Intronic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1176284393 21:5011814-5011836 GCGCCGTACACAAGATCGAAGGG - Intergenic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1179872788 21:44251661-44251683 GCGCCGTACACAAGATCGAAGGG + Exonic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181415319 22:22755054-22755076 GTGCCCTTCTCGAAATCACAAGG + Intronic
1181565713 22:23735993-23736015 CCGTACTACTCAGGATCACATGG - Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183405694 22:37629618-37629640 GGGCTCTACTCAAGAGCCCAGGG + Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
965337588 3:167446449-167446471 GAGCCAGACTCATGATCACAGGG + Exonic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
969700473 4:8765032-8765054 GTGCCCAACGCCAGATCACAGGG + Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
976482161 4:85557364-85557386 GAGCCCTGCTCAAGCACACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
996792448 5:127307293-127307315 GCTCCCTAGTCAAGTTCACAGGG - Intronic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1002444730 5:179282899-179282921 GCTCCCATCTCAAGATGACATGG - Intronic
1011067293 6:83341056-83341078 ATGCCCTACCCCAGATCACATGG - Intronic
1014066631 6:117134629-117134651 GCATCCTACTCAAATTCACATGG + Intergenic
1015629299 6:135215446-135215468 GCGCCATACTCAAGGTTACCTGG - Intronic
1018662754 6:166103344-166103366 GTGCACTGCTCAGGATCACAAGG + Intergenic
1027219792 7:76206599-76206621 GAGCCCTATTCTAGATGACATGG - Intronic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1055068219 9:72140311-72140333 TCTCCCTCCTCATGATCACAAGG - Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1061899158 9:133664194-133664216 ATGTCCAACTCAAGATCACATGG - Intronic
1187435567 X:19265754-19265776 GAGACCTGCTCAAGCTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1199684541 X:150254679-150254701 GCCCCTCACTCCAGATCACAGGG + Intergenic
1199760234 X:150899064-150899086 GAGCCCTTCTCAAGGTCACCCGG - Intergenic