ID: 1189129118

View in Genome Browser
Species Human (GRCh38)
Location X:38480093-38480115
Sequence GTTTTCTCATTGTGTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 9, 3: 42, 4: 461}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189129117_1189129118 6 Left 1189129117 X:38480064-38480086 CCTTGTGATCTTGAGTAGGGCGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1189129118 X:38480093-38480115 GTTTTCTCATTGTGTCTCTGTGG 0: 1
1: 0
2: 9
3: 42
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189129118 Original CRISPR GTTTTCTCATTGTGTCTCTG TGG Intronic
900859373 1:5217243-5217265 GATTTCTGAATGTGTCTGTGAGG - Intergenic
902446633 1:16470099-16470121 TATTTCTCACTGTGTCTTTGAGG + Intergenic
904493175 1:30872660-30872682 GTTTTGTCCTGGTCTCTCTGGGG - Intronic
904571029 1:31465306-31465328 GTTTTGTCATTGTGTCTGGGAGG - Intergenic
907530773 1:55094087-55094109 GTTTTCTGATTCTATCTCTTAGG - Exonic
907850758 1:58252641-58252663 TTTATCTCATTGAGTTTCTGTGG - Intronic
907954876 1:59218560-59218582 TATTTCTGGTTGTGTCTCTGTGG - Intergenic
908616046 1:65924010-65924032 TTTTTCTCATTTTGTCTTTCTGG + Intronic
909812665 1:79950786-79950808 ATTGGCTCATTGTCTCTCTGTGG - Intergenic
910468925 1:87529740-87529762 GCTTTCTCATTGAGTTTCTAAGG + Intergenic
910745623 1:90571092-90571114 GTTTTTTCATTTTTTTTCTGGGG - Intergenic
911297883 1:96139726-96139748 GTTTTGTGCTTGTGTTTCTGGGG + Intergenic
911832900 1:102577401-102577423 ATTTTCTCATAGTGTTTTTGGGG - Intergenic
912723888 1:112042417-112042439 GTTTTCTCATTGGCTCTCTTTGG - Intergenic
913301166 1:117370426-117370448 GTTATCTCTTTGTATTTCTGTGG + Intronic
913397692 1:118390149-118390171 ATTTTCACATTGTGTAGCTGAGG - Intergenic
913998451 1:143671732-143671754 GATTTCTCACTGTGTCTCTGAGG - Intergenic
914508943 1:148314144-148314166 GATTTCTCACTGTGTCTCTGAGG - Intergenic
914942927 1:152038212-152038234 GTTTTCGGATTTTGTCTTTGTGG - Intronic
915161593 1:153924183-153924205 GTTTTCTCACTGTGTCTCCCAGG + Intergenic
915815898 1:158964260-158964282 GCTTTCTCCTTGTCTCTCTCAGG - Intronic
916407298 1:164510016-164510038 TATTTCTCAATGTGTCTGTGAGG - Intergenic
916832154 1:168504143-168504165 ATTTCCTCATTCTGTCTTTGTGG - Intergenic
917047184 1:170874139-170874161 GTTTGCTCATTGTCACTCGGTGG - Intergenic
917069310 1:171132404-171132426 CTTTTCTCATTGTGTGTCCTTGG - Intergenic
917169732 1:172157863-172157885 GTTGTCTCTTGGTGTCTGTGAGG - Intronic
917917430 1:179716950-179716972 CTTTTCTCATTGTGTATCCTTGG + Intergenic
918190307 1:182167603-182167625 AGGTTCTCATTCTGTCTCTGAGG + Intergenic
918547464 1:185701062-185701084 TTTTTCTCTTTGTTTCTCTCTGG + Intergenic
918795719 1:188893233-188893255 CTTTTCTCATTGTATTTTTGTGG - Intergenic
919086463 1:192926435-192926457 ATTCTCTCATTCTATCTCTGGGG + Intergenic
919460337 1:197869771-197869793 GTTTTCTATTTGTGTTTCTACGG - Intergenic
919569778 1:199233273-199233295 GTTTTTTCTTTGTTTCTATGTGG - Intergenic
920268393 1:204744132-204744154 TATTTCTGAGTGTGTCTCTGAGG - Intergenic
920676467 1:208041756-208041778 TTTTTCTCATTTTGTCTAGGAGG + Intronic
920751543 1:208682643-208682665 TTTCTTTCATTGTGTCTCGGTGG + Intergenic
920992175 1:210950021-210950043 TTGTTCTCTTTGTGTCTGTGTGG - Intronic
921231270 1:213074435-213074457 AATTTCTAAATGTGTCTCTGAGG + Intronic
922036150 1:221850646-221850668 GTTTTCTCATTCTGTCCCGAGGG - Intergenic
922254457 1:223880860-223880882 TTTTTCTAATTGTGTCTCCTGGG - Intergenic
922986431 1:229869409-229869431 GTTTTCTCAGAGTTTGTCTGTGG - Intergenic
923110386 1:230885341-230885363 GTTTTCTCCTTCTGCCTCTCTGG + Intergenic
923295514 1:232591142-232591164 GTTTTGTCATTGTTCCTATGTGG - Intergenic
1063085891 10:2817423-2817445 AATTTTTCAATGTGTCTCTGAGG - Intergenic
1063732805 10:8718842-8718864 GTTTTCTCACTGTGTCATGGGGG + Intergenic
1063736069 10:8756647-8756669 TTTTGTTCTTTGTGTCTCTGTGG + Intergenic
1064176739 10:13081679-13081701 GTCTTGTCATTGTGTCTGGGAGG - Intronic
1064353228 10:14595930-14595952 ATTTTGTCAGTGTGTCCCTGTGG - Intronic
1064519827 10:16189418-16189440 GTTTTCTAATTGAGTAGCTGAGG + Intergenic
1064531392 10:16314121-16314143 GATTTGACATTGTGTCTCTTAGG - Intergenic
1065835656 10:29655588-29655610 TTTTTCTGGGTGTGTCTCTGAGG - Intronic
1065871843 10:29962588-29962610 GCTTTCTCAGTGTGTCGCTTTGG + Intergenic
1066304603 10:34128567-34128589 GATTTCTGATTGTGTGTGTGAGG + Intronic
1066930554 10:41752875-41752897 CTTTTTTGGTTGTGTCTCTGCGG - Intergenic
1068203048 10:53809088-53809110 TTTTTCTCCTTCTGACTCTGTGG + Intronic
1068543966 10:58326346-58326368 GTTTTCTCCTTGTGTTGTTGAGG - Intergenic
1068748926 10:60568876-60568898 CTTTCCTCAGTGTGTATCTGTGG - Intronic
1069921306 10:71817376-71817398 TTTTTCTACTTGTGTGTCTGGGG - Exonic
1070664700 10:78334783-78334805 GCTTTGTTATTGTGTCTCTGTGG - Intergenic
1072020960 10:91401014-91401036 TTTTTCTCATTGTGTGTCCCTGG - Intergenic
1072034021 10:91548144-91548166 GATTTCTCTTTGTGTCACTGGGG - Intergenic
1072443149 10:95475112-95475134 GCCCTCTCATTGGGTCTCTGGGG - Intronic
1073617932 10:105016795-105016817 CTCTACTCATTGTGTCTATGGGG + Intronic
1073770732 10:106732609-106732631 GTTTTAACCTTGTGTTTCTGGGG - Intronic
1073954506 10:108853838-108853860 GTTTCCTCAATGTGGTTCTGAGG + Intergenic
1075293049 10:121246910-121246932 TTTTTCTCATTGTGCTTTTGGGG + Intergenic
1076532359 10:131153502-131153524 ATTTTCTCATTGACTTTCTGAGG + Intronic
1076990742 11:272257-272279 GCTTTCTCTCTGGGTCTCTGTGG + Intergenic
1077033774 11:483824-483846 GTTTTCTCAGTATTTGTCTGGGG + Intronic
1077745412 11:4898535-4898557 ACTTTCTCATTGTTTCTATGGGG + Intronic
1077753080 11:4994986-4995008 AATTTCTCTTTGTGTGTCTGTGG - Intergenic
1081055382 11:38404046-38404068 CTTTTCTCATTGTGTATATCTGG + Intergenic
1081493925 11:43587395-43587417 TTTTTTTCATTGAGTCTCTAAGG + Intronic
1081567661 11:44269981-44270003 GGGTTCTCCTTGTGTCTCTGTGG + Intronic
1081948979 11:47026279-47026301 GTGTTTTCATGGTTTCTCTGGGG - Intronic
1082653601 11:55825123-55825145 TTTTTCTCATTGTGTATTAGGGG + Intergenic
1082682895 11:56200469-56200491 GTATTTACATTCTGTCTCTGAGG + Intergenic
1082913741 11:58407915-58407937 TTTTTCTCATTGTGCAACTGAGG + Intergenic
1085506234 11:77061819-77061841 GTTTTATCATTGATTCTCTGGGG + Intergenic
1086097544 11:83065662-83065684 TTTTCCTCATTTTGTCACTGTGG + Intronic
1086323581 11:85675610-85675632 GTGTTCACTTTGTGTCTCTGTGG - Intronic
1086473669 11:87146188-87146210 CTTTTCCCATTGTGTATTTGTGG + Intronic
1086905978 11:92418432-92418454 GTTTTCTCTGTGTGTGTGTGGGG - Intronic
1087219420 11:95530252-95530274 ATTTCCTCATTGTGTGTCAGTGG - Intergenic
1087279554 11:96195001-96195023 TTTTTCTGACTGTGTCTATGAGG + Intronic
1087624350 11:100579953-100579975 TATTTCTCAGTGTGTCTGTGAGG - Intergenic
1087954850 11:104273085-104273107 GCTTTCTCATTGTGTCTCTTTGG - Intergenic
1088682072 11:112252030-112252052 GTTTTCACATTGTGTCTATGTGG + Intronic
1088786322 11:113185457-113185479 TTGTTCTGATTGTGTCTGTGAGG - Intronic
1089035957 11:115391709-115391731 GTTTTGTCAGTGTGAATCTGAGG - Intronic
1089067736 11:115674693-115674715 GTTTTCTGCCTGTGTGTCTGTGG - Intergenic
1089374898 11:117987135-117987157 GCTCTTTCATTCTGTCTCTGGGG - Intronic
1089892600 11:121896432-121896454 GCTTCCTCATTCTGTTTCTGTGG + Intergenic
1090108950 11:123884074-123884096 GTTTTCTTCTTGTCTGTCTGTGG - Exonic
1090562128 11:127943590-127943612 TTTTGGTCATTGTGCCTCTGGGG + Intergenic
1097331941 12:58340590-58340612 AATTTTTCATTTTGTCTCTGTGG + Intergenic
1098549598 12:71748565-71748587 GAATTCTCCTTTTGTCTCTGAGG + Intergenic
1098683310 12:73385667-73385689 ATTTTGTCATTTTCTCTCTGAGG + Intergenic
1099593210 12:84622831-84622853 TTTGTCTTATTCTGTCTCTGAGG + Intergenic
1099793970 12:87372453-87372475 TTTTTCTCATTGTGTCTTCTTGG + Intergenic
1100598400 12:96091161-96091183 GCTTTCTCATTTTCTTTCTGTGG + Intergenic
1101158564 12:101951214-101951236 GTTTGCTGATTGTGTCGCTGTGG + Intronic
1101744295 12:107526783-107526805 GTTTTCTTCTTGTGACACTGAGG - Intronic
1102676696 12:114664386-114664408 GATTTCTCTCTGTGTCTCTCAGG - Intergenic
1102777776 12:115535505-115535527 GATTTCTCAGAGTGTGTCTGTGG + Intergenic
1108448898 13:50540046-50540068 GTTTTCTCATTGCTTTTATGGGG + Intronic
1108615039 13:52124556-52124578 GTTTTCTAACTGTTTATCTGTGG + Intronic
1108774553 13:53749647-53749669 ATTATCTCAGTGTTTCTCTGAGG + Intergenic
1108943282 13:55986497-55986519 GTTTTCTCATTGTGTATTCTTGG + Intergenic
1110089037 13:71421762-71421784 CTTTTCACATTGTGTCTTTTTGG + Intergenic
1110126313 13:71947387-71947409 GTTTTCTCCTGGTGGCACTGGGG - Intergenic
1110998980 13:82153061-82153083 GTCTTCTCATTGTGTATCAAAGG - Intergenic
1112849583 13:103688584-103688606 GATTTGTCATTGTGTCTTTATGG + Intergenic
1113308914 13:109110256-109110278 TTTTTCACAATGTGTCTCTTTGG + Intronic
1113318810 13:109212629-109212651 TTTTTCTCATTGAGTCTTTGTGG - Intergenic
1113345296 13:109472015-109472037 GTTTTCTTATTTTCTTTCTGAGG - Intergenic
1113559119 13:111263725-111263747 GATATTTCACTGTGTCTCTGAGG + Intronic
1114028772 14:18556761-18556783 GTTTTCCCATTTTGCCTTTGAGG - Intergenic
1114389741 14:22294195-22294217 ATTTTCTCATTATTTATCTGAGG + Intergenic
1114971399 14:28033869-28033891 CTTTTCTGATTGTGTCTATTTGG + Intergenic
1115419842 14:33181949-33181971 CTTTTCTCCTTGTTTCTCCGTGG + Intronic
1116392050 14:44404487-44404509 CTTTTGTCATTGTCTGTCTGGGG - Intergenic
1116419027 14:44711893-44711915 GTTTTCTGATTCTGAATCTGGGG + Intergenic
1116979853 14:51157030-51157052 GTTTTCTTATTTTGTGTATGTGG + Intergenic
1117062600 14:51978722-51978744 GTTATCTCATTCTGATTCTGTGG - Intronic
1117232517 14:53735668-53735690 GTTTTCTCATTTTCTCTTTTGGG + Intergenic
1117498584 14:56330183-56330205 GTTCTCTCATTTTATCTGTGGGG + Intergenic
1117810232 14:59537540-59537562 ATTTTTTTATTGTGTTTCTGTGG + Intronic
1117933468 14:60873287-60873309 TTTTTCTGATTTTTTCTCTGTGG + Intronic
1118686288 14:68294839-68294861 GTTTTCTCTTTGTCACTCTGGGG + Intronic
1119158340 14:72431914-72431936 ATTTTCTCATTTTGAATCTGGGG + Intronic
1119594580 14:75922690-75922712 CTTTTTTTGTTGTGTCTCTGCGG + Intronic
1121877856 14:97470441-97470463 GTTTTCTCATGGATACTCTGAGG + Intergenic
1122071671 14:99209205-99209227 GAGTCCTCATTGTGACTCTGTGG - Intronic
1122358539 14:101140747-101140769 GTTTTGTCTTTATGTCTCTTAGG + Intergenic
1202839576 14_GL000009v2_random:109196-109218 GTATTTAAATTGTGTCTCTGTGG - Intergenic
1202908946 14_GL000194v1_random:99336-99358 GTATTTAAATTGTGTCTCTGTGG - Intergenic
1202884314 14_KI270722v1_random:89895-89917 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1123694038 15:22863972-22863994 TCTGTTTCATTGTGTCTCTGAGG + Intronic
1123702494 15:22925868-22925890 GTTTACTCATTGCTTCTGTGTGG - Intronic
1125144299 15:36448631-36448653 GGTTGCTTATTATGTCTCTGTGG - Intergenic
1126144990 15:45465777-45465799 GATTTCTGGGTGTGTCTCTGAGG + Intergenic
1126275707 15:46877667-46877689 TTTTTCTCATTGAATTTCTGTGG - Intergenic
1126487284 15:49195608-49195630 GTTTTATCATTACTTCTCTGTGG + Intronic
1126537924 15:49787355-49787377 GTTTTCTTGTTGTGTCTGTGTGG + Intergenic
1127135967 15:55924013-55924035 TTTTCCTAATTTTGTCTCTGAGG - Intronic
1128331442 15:66758053-66758075 TTGTTGTCATTGTGTGTCTGCGG + Intronic
1128453128 15:67818655-67818677 GTTTTCTCACTGTGTTTCCATGG + Intergenic
1129581350 15:76814497-76814519 CTTTTCTCATTGTGTTTTTTTGG - Intronic
1129746935 15:78028775-78028797 GTTTGCTGATTGTATTTCTGTGG - Intronic
1130068621 15:80627929-80627951 GATTTCTGGTTGTGTCTGTGAGG + Intergenic
1130165939 15:81458783-81458805 GTTTTCTTTTTTTGTCTTTGTGG + Intergenic
1130609433 15:85347525-85347547 GTTTTCTCATTGTGGGTATTGGG + Intergenic
1131443567 15:92476961-92476983 GTTTTCTCCTGGTGTTTCTGGGG + Intronic
1131988332 15:98067191-98067213 GTTGTGTCATTGTGTCTATCTGG - Intergenic
1133574433 16:7074899-7074921 GTTTTCACAATGTCTCACTGGGG - Intronic
1133763008 16:8814767-8814789 GTTTAATCATTGTGCCTCTTTGG + Intronic
1134754469 16:16654596-16654618 GTTTTCTCTTTTTGGCTCTGGGG + Intergenic
1134991592 16:18704442-18704464 GTTTTCTCTTTTTGGCTCTGGGG - Intergenic
1135031731 16:19044193-19044215 TTTTTCTCACTCTGTCCCTGAGG + Intronic
1135632485 16:24047011-24047033 TTTTTCTCACTGTGTTGCTGAGG - Intronic
1138912488 16:61418460-61418482 GATTTCTCATTGTGTGCCTTTGG + Intergenic
1138972462 16:62162046-62162068 GTTTTATTTTTGTGTCTCAGGGG + Intergenic
1139331688 16:66197151-66197173 GTTTTCTAATTGAGTGGCTGTGG - Intergenic
1140263556 16:73401085-73401107 GTTTTCTCATTAGGTGGCTGGGG - Intergenic
1140345588 16:74209905-74209927 GTTTTCTCTCTGCATCTCTGTGG - Intergenic
1140836391 16:78798055-78798077 GTCTTCTCCTTTTGTTTCTGGGG + Intronic
1141592623 16:85078612-85078634 ATTTTCTCACTGAGTTTCTGTGG + Intronic
1142435680 16:90055413-90055435 GTACTCTCATTGTGTCTTGGAGG + Intergenic
1142483167 17:230775-230797 TTTCTCTCCGTGTGTCTCTGGGG + Intronic
1143727379 17:8858616-8858638 GTTTTCTCAATGAGTCTCAATGG + Intronic
1144662318 17:17079176-17079198 GTTTTCTACTTTTGTTTCTGGGG + Intronic
1146987467 17:37234126-37234148 GTTTTCTTTTTGTCTCTTTGTGG - Intronic
1147426461 17:40348060-40348082 GGTTTATCATTGTATCTTTGTGG + Intronic
1148760179 17:49995624-49995646 GTTTGCCCATTGTGTGTTTGTGG + Intergenic
1150275986 17:63898232-63898254 GGAGTCTCATTCTGTCTCTGAGG + Intergenic
1151046003 17:70919984-70920006 TTTTTCTGAATGTGTCTGTGAGG - Intergenic
1153162490 18:2223462-2223484 GTTTTCTCTTTTAGTCTCTTAGG - Intergenic
1153508491 18:5828249-5828271 GTCTTTCCATTATGTCTCTGGGG + Intergenic
1153527752 18:6013943-6013965 GTTTTCTCATAGCCACTCTGAGG + Intronic
1153800933 18:8667996-8668018 GTTTTCTTATTTTGTGTATGTGG + Intergenic
1154076780 18:11211104-11211126 GTCTTCTCTAAGTGTCTCTGTGG - Intergenic
1155435005 18:25803279-25803301 GTTTTCTCACTTTCTCTATGAGG - Intergenic
1157395866 18:47340277-47340299 CATTTCTGAGTGTGTCTCTGAGG + Intergenic
1158729593 18:60008520-60008542 TTTTTCTCATTGTTACGCTGGGG + Intergenic
1159084272 18:63770394-63770416 GTTTTCTCATAGTTACTCTATGG + Intronic
1160055017 18:75471027-75471049 GTTTTCTCCCTGGATCTCTGTGG + Intergenic
1161613414 19:5256774-5256796 GGTTTTGCATTTTGTCTCTGAGG - Intronic
1162477689 19:10910878-10910900 GTTTTCTCTTTCTGTTTTTGGGG + Intronic
1164102235 19:22066929-22066951 GTTCTATCATTGTGTTTCTCTGG + Intronic
1165953163 19:39486068-39486090 GTTCTCTCCCTCTGTCTCTGTGG - Intronic
1166223811 19:41382646-41382668 TTTTTCTCTTTGTATCTCTGGGG + Intronic
1167675466 19:50881944-50881966 GTTTTCTCTTTGTGTTCCTGTGG - Intergenic
1168510569 19:56970465-56970487 GGTATCTCATTGTCTCTATGTGG - Intergenic
1202633469 1_KI270706v1_random:21367-21389 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1202659727 1_KI270708v1_random:57024-57046 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
925304024 2:2836478-2836500 GTTTTGTCCTTGGGTCTATGGGG - Intergenic
925579954 2:5400312-5400334 TATTTCTGACTGTGTCTCTGAGG - Intergenic
926437237 2:12850561-12850583 ATTTTCTCATTGTGACTCTCAGG + Intergenic
926963664 2:18386844-18386866 TATTTCTGAGTGTGTCTCTGAGG + Intergenic
927540342 2:23904654-23904676 GTTTTTTCTTTGTCTCTTTGAGG - Intronic
927907797 2:26873854-26873876 TTTTTCTGAGTGTGTCTGTGAGG - Intronic
928051833 2:28006172-28006194 TTTTGCTGATTGTATCTCTGTGG + Intronic
928230353 2:29493536-29493558 GTTTTCTCTTTTATTCTCTGAGG + Intronic
928365441 2:30697070-30697092 GTATTCCAATTGTTTCTCTGTGG + Intergenic
928771416 2:34706298-34706320 ATTTTGTACTTGTGTCTCTGGGG - Intergenic
929639797 2:43566313-43566335 TATTTCTCAGTGAGTCTCTGTGG - Intronic
929806687 2:45152755-45152777 GTTTTGCCATTTGGTCTCTGAGG - Intergenic
930062126 2:47298936-47298958 GTTTTCTGATAATGTCTCTTTGG + Intergenic
931135914 2:59400606-59400628 ATTTTCTTTTTGTGTTTCTGTGG - Intergenic
932431767 2:71679819-71679841 GTTTTCTCATTTTTCCTTTGGGG - Intronic
932654018 2:73592510-73592532 GTTTTATCAATGTGTGTCTCTGG + Intronic
932932580 2:76059831-76059853 GTTTTTTGATTGAGTCTTTGGGG + Intergenic
933063695 2:77768879-77768901 TTTTTCTCCTTGTCTGTCTGTGG - Intergenic
933977151 2:87520732-87520754 GATCTCTCATTGGGTCTCTTTGG + Intergenic
935480378 2:103580787-103580809 ATTTTTTCATGGTTTCTCTGGGG + Intergenic
935521462 2:104110457-104110479 CTATTCACTTTGTGTCTCTGTGG + Intergenic
936316666 2:111430073-111430095 GATCTCTCATTGGGTCTCTTTGG - Intergenic
939489159 2:142856205-142856227 GTCTTCTAATTTTGTCTCTAAGG - Intergenic
940184902 2:150972962-150972984 GTGTTCAGTTTGTGTCTCTGTGG - Intergenic
940365259 2:152841297-152841319 CTTTTCTCATTGTGTCTTCTTGG + Intergenic
940413091 2:153388975-153388997 GATTTCTCATTGTTTCCCTGAGG - Intergenic
941081066 2:161061262-161061284 TGTTCCTCATTGTGTCTGTGAGG + Intergenic
942462557 2:176178333-176178355 GTTTTCTCTGTGTGTGTCTAGGG + Intergenic
942669455 2:178358479-178358501 CTTTTCTCATTGTGCCTTTTTGG - Intronic
943442691 2:187945349-187945371 TTATTCTCAGTGTGTCTGTGAGG + Intergenic
943705516 2:191029532-191029554 TATTTCTCATTTTGTCTCTCTGG - Intergenic
943764213 2:191643378-191643400 GTTTTCTCATTGGTTTTTTGGGG - Intergenic
943844945 2:192634157-192634179 GTTTTTCCATTGTGTGTTTGGGG + Intergenic
944743084 2:202631331-202631353 ATTTTCTCATTTTCTCTCCGAGG - Intergenic
945826985 2:214732839-214732861 GTTTTGTTATTGTGTCAGTGTGG - Intronic
945957839 2:216102775-216102797 TTTTGCTCATTTTGTCTTTGAGG + Exonic
946216047 2:218184343-218184365 TTTTTCTCATGATGCCTCTGAGG - Intergenic
947065141 2:226216339-226216361 ATTTCCTCAGTGTCTCTCTGCGG + Intergenic
947195903 2:227567469-227567491 GTGTTCTCATAGTATTTCTGTGG + Intergenic
947950952 2:234146812-234146834 GTTTCCTCAATGGGTCTCTAAGG + Intergenic
948771639 2:240254260-240254282 CTTTTCTCATTGTCTCTGGGTGG + Intergenic
1170370942 20:15647491-15647513 ATTTTCTTCTTGTGTCTCAGTGG - Intronic
1170396397 20:15930677-15930699 GTTTTCTCTTTGAGTCTCAGCGG - Intronic
1171008686 20:21493788-21493810 GTGTGCTCTCTGTGTCTCTGTGG - Intergenic
1171468144 20:25347121-25347143 GTTTTCTCTTTCTGGTTCTGTGG - Intronic
1173133194 20:40413918-40413940 TTTTTCTCATTTTTTCTTTGTGG - Intergenic
1173237328 20:41258593-41258615 GTTTTCTCATGATTACTCTGAGG + Intronic
1174389674 20:50210467-50210489 GTTCACCCATTGTTTCTCTGTGG - Intergenic
1175662368 20:60824858-60824880 GTTTTCTCATTATGAGACTGCGG + Intergenic
1176148535 20:63576566-63576588 GGTTTCTCCTAGTGCCTCTGTGG - Intergenic
1176412153 21:6454899-6454921 GGTTTCTCATCCTGCCTCTGAGG - Intergenic
1176599739 21:8780953-8780975 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1176628308 21:9114052-9114074 GTATTTAAATTGTGTCTCTGTGG - Intergenic
1176645684 21:9347231-9347253 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1176927086 21:14763735-14763757 ATTTTCTCTGTGTTTCTCTGTGG - Intergenic
1176951186 21:15048226-15048248 GTTTTCAGTTTGTGTCTTTGTGG - Intronic
1177325836 21:19587615-19587637 TTTTTCTGCTTGTGTCTGTGAGG + Intergenic
1178242143 21:30915190-30915212 GTTTTCTCATTGCGTATTTTTGG - Intergenic
1178310159 21:31523554-31523576 GTTTACTAATTGTGTGACTGTGG + Intronic
1178577797 21:33810397-33810419 ATTTTCTCATCATGTGTCTGTGG + Intronic
1179687647 21:43063221-43063243 GGTTTCTCATCCTGCCTCTGAGG - Intronic
1180327198 22:11440586-11440608 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1180367245 22:11951923-11951945 GTGTTTAAATTGTGTCTCTGTGG - Intergenic
1180378839 22:12119416-12119438 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1180418692 22:12793903-12793925 GTGTTTAAATTGTGTCTCTGTGG - Intergenic
1180452891 22:15483823-15483845 GTTTTCCCATTTTGCCTTTGAGG - Intergenic
1180890771 22:19286946-19286968 GTTCCCTCAAAGTGTCTCTGAGG - Intronic
1181004953 22:20008892-20008914 GTCTTCTCTATGTTTCTCTGTGG - Intronic
1181473702 22:23156138-23156160 GTTTTCTCAGTGGGTCTTGGAGG - Intronic
1181561278 22:23702953-23702975 TTTTTCCCATTGTGTCTTTTTGG - Intergenic
1183337101 22:37256170-37256192 GTTTTCCCAGAGTGGCTCTGAGG + Intergenic
949095376 3:79479-79501 GATTTCTAATTGTGTCTCGCTGG - Intergenic
950112279 3:10426924-10426946 CTTCTCTCATGGGGTCTCTGTGG - Intronic
950156119 3:10722991-10723013 CTTTTCTGATTTTGGCTCTGAGG - Intergenic
950300421 3:11872598-11872620 GTTTTCTCATTTTCCTTCTGCGG - Intergenic
950609199 3:14114407-14114429 GTTTACTCATGCAGTCTCTGGGG + Intronic
951491658 3:23276224-23276246 GTTTACTGATTGTGTCTTGGTGG - Intronic
953435695 3:42875528-42875550 GTTTTCTCTGTGTGTCCTTGAGG + Exonic
953440812 3:42915402-42915424 GTCATCTCATTTTGTCTCTAGGG - Exonic
954349122 3:50027849-50027871 GTTTTAGCATTGTGGCTCTTTGG - Intronic
954409267 3:50363258-50363280 GCTTTCTCAGTGTGTGTGTGTGG - Intronic
955287298 3:57654650-57654672 GTTTCCTCATTCTGTTTTTGAGG - Intronic
956019643 3:64920585-64920607 TGTCTCTCATTGTGTCTCTTTGG + Intergenic
956028957 3:65015548-65015570 GTTTTCTTTTTGTACCTCTGAGG - Intergenic
956497609 3:69845464-69845486 GTTTTCTCAGAGTTTCTGTGAGG - Intronic
956882882 3:73529055-73529077 GTTTTTGTTTTGTGTCTCTGTGG + Intronic
957094524 3:75766262-75766284 GTGTTTAAATTGTGTCTCTGTGG - Intronic
957632745 3:82738778-82738800 CTTTTCTCATTGTGTCTTTTTGG + Intergenic
957789729 3:84924518-84924540 TTTTTTTCACTGTGTTTCTGAGG - Intergenic
959244597 3:103848787-103848809 ATTTTATGATTGTGCCTCTGAGG + Intergenic
960549401 3:118957312-118957334 TTTTTCTGAGTGTGTCTGTGGGG - Intronic
961469032 3:127099980-127100002 GTTTTCTCACTGTGACTCGATGG + Intergenic
961776038 3:129286301-129286323 GTTGTCACATGGTATCTCTGGGG - Intronic
962510886 3:136099438-136099460 TTCTTCTCATAGTCTCTCTGAGG - Intronic
963211080 3:142691069-142691091 GATTTCTCATTCTGTCTCACTGG - Intronic
964737421 3:159931057-159931079 ATTTTCTCATTTTTCCTCTGTGG - Intergenic
965995861 3:174882193-174882215 TTGTTCTCTTTGTATCTCTGTGG + Intronic
966536708 3:181043212-181043234 CTTTTTTTGTTGTGTCTCTGGGG + Intergenic
966945976 3:184777349-184777371 ATTTCTTCTTTGTGTCTCTGAGG - Intergenic
967001738 3:185342233-185342255 ATTTTCTCATACAGTCTCTGAGG - Intronic
967077258 3:186014749-186014771 TTTTTCTCATTGTTTAACTGGGG + Intergenic
967463979 3:189780924-189780946 TTTTTCTCATTTTGTGTTTGTGG + Intronic
967475069 3:189907075-189907097 CATTTCTGATTGTGTCTGTGAGG - Intergenic
968041011 3:195589313-195589335 ATTTTCTCTTTGTGTGACTGTGG + Intergenic
1202741204 3_GL000221v1_random:57836-57858 GTGTTTAAATTGTGTCTCTGTGG - Intergenic
968895130 4:3395843-3395865 GTTTTCCCTTAGTGTCTCTAGGG + Intronic
969708130 4:8824215-8824237 GTTTCCTCTTTGTCTTTCTGTGG - Intergenic
970207370 4:13668443-13668465 GTTGTCTCAGTGTGTGTTTGTGG + Intergenic
970232361 4:13923860-13923882 GTTTTTTCATTGTCTCTCAAAGG + Intergenic
970276097 4:14402912-14402934 GATTTCTCATTGTGTCTGTGAGG + Intergenic
970285149 4:14504563-14504585 CTTTTCTGATTGTGTTTCTTTGG + Intergenic
971428606 4:26540367-26540389 GATTTCTGAGTGTGTCTGTGAGG - Intergenic
972636674 4:40890489-40890511 GTTTTCTCGTTGTGTCCCAGGGG - Exonic
973289882 4:48460349-48460371 GTTTTCTCCTTGAGTCCATGAGG - Intergenic
973363095 4:49183374-49183396 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
973397998 4:49613485-49613507 GTGTTTAAATTGTGTCTCTGTGG - Intergenic
975432241 4:74306941-74306963 GTTTTCTCACTCTGTCACTCAGG - Intergenic
976045423 4:80940965-80940987 GTTTTCCCTTTGTTTCTGTGGGG + Intronic
976377769 4:84364488-84364510 GTTTTCTCATTTTATTTCTATGG + Intergenic
976514822 4:85953340-85953362 ATTTTTTCATTTTATCTCTGTGG - Intronic
976677438 4:87718898-87718920 GTGTTCTCGTTGTGTCTGTCAGG - Intergenic
976871807 4:89803341-89803363 GTTTTCTCCATGTGTTTTTGTGG + Intronic
977040598 4:92012566-92012588 CTTTTTTCATTGTGTCTCTGCGG - Intergenic
977061147 4:92258271-92258293 GTTTTCTAATTGTTTATCAGTGG + Intergenic
977846276 4:101771737-101771759 GTTCTCTCATTTTCTCTCTCAGG + Intronic
978013346 4:103713960-103713982 GATTTCTCAGTGTGGCTCTTTGG + Intronic
978344470 4:107752563-107752585 TATTTCTCAGTGTGTCTGTGAGG - Intergenic
978585520 4:110272270-110272292 TTTTTCTCAGAGTGTCTGTGTGG - Intergenic
978920143 4:114174293-114174315 GTTTTCTGATTGTTCCACTGTGG - Intergenic
980467288 4:133202557-133202579 ATTTTTATATTGTGTCTCTGTGG + Intronic
981504456 4:145483389-145483411 GTTTTCTCATTGTGTTACTGAGG - Intronic
981637702 4:146899362-146899384 GCATTCTCACTGTGTCTGTGGGG - Intronic
981979072 4:150769984-150770006 GATTTCTGGTTGTGTCTGTGAGG + Intronic
982065045 4:151646994-151647016 GTTTTCACATTTTGACTCTGAGG - Intronic
982799861 4:159692128-159692150 TGTTTCTCAGTGTGTCTGTGAGG + Intergenic
983881657 4:172939838-172939860 ATTTTCTCATTTCTTCTCTGTGG - Intronic
984696945 4:182788408-182788430 GTGTTGTCATAGAGTCTCTGTGG - Intronic
985037021 4:185850768-185850790 GATTTCTGAGTGTGTCTGTGAGG + Intronic
1202760455 4_GL000008v2_random:104892-104914 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
985520385 5:371443-371465 GCTTTCTGAGTGAGTCTCTGGGG + Intronic
985531362 5:435589-435611 GAGTTCTCAGTGGGTCTCTGCGG + Exonic
985562700 5:599057-599079 GTTTGCCCATTTTGCCTCTGTGG + Intergenic
985802197 5:2011953-2011975 GTCTTCTCTTTGTGTGGCTGTGG + Intergenic
988688432 5:33548335-33548357 ATTTTCTCATTGTGTGTCTCAGG + Intronic
989150388 5:38293541-38293563 GTTTTCACATTTTGTGTGTGTGG - Intronic
989274705 5:39574303-39574325 GTTTTGTTATTATGACTCTGGGG - Intergenic
989708832 5:44371838-44371860 GTTTTCTCATTCCGTCTATGAGG - Intronic
990485946 5:56259335-56259357 CTTTACTCACTGTGTCTCTGGGG + Intergenic
990852815 5:60226417-60226439 GTTTTTTCTTTGGTTCTCTGGGG - Intronic
990957767 5:61360863-61360885 GTTTTCGCCTTGTCTCACTGAGG + Intronic
992981834 5:82183400-82183422 TTTTTCTAATTGTATTTCTGTGG + Intronic
993094924 5:83471143-83471165 GTTTTCTCAGTGTCTCTTTCAGG + Intergenic
993588974 5:89770230-89770252 GTGTTTCCATTGTGTCTCTATGG + Intergenic
993728530 5:91395848-91395870 GTTATCTGGTTGTGTCTGTGAGG - Intergenic
994133967 5:96263540-96263562 CTTTTCTCTTTGTGCCCCTGTGG - Intergenic
996466718 5:123811169-123811191 ATTTTCTCTTTTTGTCTTTGAGG + Intergenic
996816782 5:127582997-127583019 GTTTTCTCATAGTTACACTGAGG - Intergenic
997371271 5:133362545-133362567 GCTTTCTCAGTGCGTCTGTGGGG + Intronic
999081862 5:148852054-148852076 GTTATCTCACTCTGTCTCTCTGG + Intergenic
999879571 5:155846617-155846639 GATTTCTCATTGGTTCTCAGAGG + Intergenic
1000023247 5:157337199-157337221 GCTTTCTGATTCTGTCTCTTGGG - Intronic
1000213499 5:159132081-159132103 GTTTTCTGATTGTGTCCTAGGGG + Intergenic
1001254079 5:170170548-170170570 TTTTGGTCATTGTGACTCTGGGG - Intergenic
1002346768 5:178553546-178553568 GTTTTCTTTTTGTGTCTTTTTGG - Intronic
1002403525 5:179009497-179009519 GTATTCTGAGTGTGTCTGTGAGG - Intergenic
1002877562 6:1225209-1225231 TTTTTCTCTTTGTATGTCTGAGG + Intergenic
1002983493 6:2165119-2165141 GTTTTCTGAATGTGATTCTGGGG - Intronic
1003606885 6:7570415-7570437 GTTTTCCCTTTGTGCCTCTTAGG + Exonic
1004314538 6:14574372-14574394 GGTTTGTCATTCTGTCTCTTGGG - Intergenic
1004509478 6:16273666-16273688 GTTTTCTAATTCTGACTCTCTGG + Intronic
1004813252 6:19283656-19283678 GTTTTCTTATAGTGTCTGTCTGG - Intergenic
1004840801 6:19582259-19582281 GTTTTATCATTGATTCTTTGAGG - Intergenic
1005194166 6:23263185-23263207 TTATTCTCAGTGTGTCTGTGAGG - Intergenic
1007231982 6:40354643-40354665 CTCTTCTCTTTGTGTCTCTTTGG + Intergenic
1007304857 6:40895758-40895780 ATTTTGTCATTTTGTCTTTGTGG - Intergenic
1007375770 6:41455677-41455699 ATTTTCCCTATGTGTCTCTGTGG - Intergenic
1008165364 6:48131785-48131807 GTTTTCCCATTGTGTATCCTTGG + Intergenic
1008233756 6:49018416-49018438 TTTTTCTAATTATGTCTGTGAGG + Intergenic
1008691629 6:53985543-53985565 ATTTTCTCCTTGTGACTCTGTGG - Intronic
1009602771 6:65823607-65823629 ATATTCTCAGTGTGTCTATGAGG + Intergenic
1009731021 6:67606940-67606962 ATCTTCTCCTTGTGTCTCTTCGG + Intergenic
1009836102 6:69003608-69003630 GATTTCCTATTGTTTCTCTGTGG + Intronic
1010799612 6:80160180-80160202 TTTTTCTCATTCTGTCTCCCAGG + Intronic
1010839020 6:80625247-80625269 GTTTTCTTTTTGTGTGTTTGTGG + Intergenic
1011764418 6:90604783-90604805 GTTATCTCATCATGTCCCTGTGG - Intergenic
1011904250 6:92341791-92341813 GTTCTCTCATTGTGTAGATGAGG - Intergenic
1012128431 6:95459491-95459513 GCTTTCTCATTGTGTGTTTTTGG + Intergenic
1012228510 6:96732692-96732714 GTTTTCTTATTGTCTCTCCGTGG + Intergenic
1012351654 6:98259161-98259183 GTTTTCTCTTTTTGTTTTTGAGG + Intergenic
1012838703 6:104302104-104302126 GTTCTCTCATTGTCGCTCTGCGG + Intergenic
1013352726 6:109319852-109319874 GGTTTGTCATTGAGCCTCTGAGG + Intergenic
1013701101 6:112770467-112770489 CTATTCTGAGTGTGTCTCTGAGG - Intergenic
1014217345 6:118765491-118765513 GGTATCTCATTGTGTCATTGTGG - Intergenic
1014657376 6:124125232-124125254 GTTCTCTCTTTCTGTCTCTGGGG + Intronic
1015267521 6:131303612-131303634 ATCTTCTCATTGTGTGTCTTGGG - Intergenic
1015305618 6:131703953-131703975 TCTGTCTCATTCTGTCTCTGAGG + Intronic
1015581614 6:134731071-134731093 GCTTTCTCATTCTTTCTCTCAGG + Intergenic
1015648487 6:135424063-135424085 GTTTTTTCTATGTTTCTCTGTGG - Intronic
1016218780 6:141638811-141638833 TTTTTCTTATTGCTTCTCTGTGG + Intergenic
1016798521 6:148143967-148143989 CCTTTCTCACTGTGTGTCTGGGG + Intergenic
1017184253 6:151585076-151585098 GTTTTCTGAGAGTGTCCCTGAGG + Intronic
1017434789 6:154406083-154406105 GTCTTCACATTCTATCTCTGGGG + Exonic
1018529218 6:164745071-164745093 ATTTTATCATTGTTTTTCTGTGG - Intergenic
1018541037 6:164879416-164879438 GATTTCTGATTGTGTCTGTGAGG + Intergenic
1018927251 6:168215020-168215042 GTTTTCTCCTCCTGTCTGTGGGG + Intergenic
1019040550 6:169100597-169100619 GTTTTCTAATTGAGTGACTGTGG - Intergenic
1020442095 7:8228321-8228343 GTTTTCTCAGTTTGTATCTTGGG - Intronic
1020680085 7:11226075-11226097 TTTCTCTCATTGGGTCCCTGAGG - Intergenic
1020802538 7:12749232-12749254 GTTTTTTCATTGTTTCTCTGAGG + Intergenic
1021151329 7:17154198-17154220 GTTTTCCAATTTTGTCTATGAGG + Intergenic
1021457212 7:20842722-20842744 TTTTTCTCATTCTGGCTCTCTGG + Intergenic
1021556559 7:21925197-21925219 GTTTTGCCATTTTGTCTGTGTGG - Intronic
1021820203 7:24489894-24489916 TTTTGCTTATTGTTTCTCTGTGG - Intergenic
1022505449 7:30906479-30906501 TTTTTCCCATCCTGTCTCTGTGG + Intergenic
1022567634 7:31419205-31419227 GTTTTCTCATTGTGTCAAATAGG - Intergenic
1022571355 7:31457223-31457245 ATTTTCTCACTGTGGCTCTCTGG - Intergenic
1022850619 7:34258139-34258161 TTTTTCTAATTGTATCCCTGCGG + Intergenic
1023789426 7:43740931-43740953 TTTTTATCATTGTTTCTCTGAGG - Intergenic
1024178535 7:46864321-46864343 GGTTTCTCACTGGGCCTCTGTGG - Intergenic
1024207758 7:47178358-47178380 TTTTTCTGAGTGTGTCTGTGAGG - Intergenic
1024412530 7:49062036-49062058 TATTTCTGAGTGTGTCTCTGAGG - Intergenic
1025318915 7:58069554-58069576 ATTTCCTAATTGTGTCTATGTGG - Intergenic
1027133463 7:75607863-75607885 GGATTCTGATCGTGTCTCTGTGG - Intronic
1029628170 7:101733534-101733556 GTTTTTTCATTTTGCCTCTCTGG + Intergenic
1031137610 7:117902079-117902101 GTTTGCACATTGTGTACCTGAGG + Intergenic
1032139436 7:129313696-129313718 TTTTTTTCATTGTGTCTATTTGG - Intronic
1033739734 7:144262184-144262206 TCTGTCTCATTCTGTCTCTGAGG + Intergenic
1034072528 7:148200139-148200161 GATTTCTGAGTGTGTCTATGAGG - Intronic
1034733329 7:153406844-153406866 TTTTTCTCATTCCGTATCTGAGG + Intergenic
1037010880 8:13840892-13840914 GCTTTCTCTTGGAGTCTCTGAGG + Intergenic
1037090612 8:14912162-14912184 GTTTTCTTGTTGTATCTCTAGGG - Intronic
1037345841 8:17900421-17900443 TTTTCCACAATGTGTCTCTGAGG - Intronic
1038593636 8:28864958-28864980 GGTGTCTCACTGTGTCTCTGAGG - Intronic
1038697072 8:29816124-29816146 GTTTTCTTAGTGTGTCTTTGAGG + Intergenic
1040040178 8:42908540-42908562 CTTTTCTCATTGGGTGTTTGTGG - Intronic
1040748704 8:50678960-50678982 GTTTTATCATTGTGTCTTGGAGG + Intronic
1041232668 8:55769294-55769316 GGATTCTCATTCTGTCCCTGAGG - Intronic
1041296236 8:56359886-56359908 TTTTTCTCTTTTTGTCTTTGTGG + Intergenic
1041308044 8:56484095-56484117 GGTTACTCATTGTGTTTCTTGGG + Intergenic
1041703076 8:60813293-60813315 GTTTTCTAATTGATTCTCTAGGG + Intronic
1041792462 8:61712929-61712951 TTCTTCTCATTGTGCCTCTAAGG - Intronic
1042478126 8:69272798-69272820 GTTGTCTCTTGGTGTCTGTGGGG + Intergenic
1043027463 8:75088125-75088147 GTTTACTCATTTTGTTTCTTAGG + Intergenic
1044544316 8:93442696-93442718 TGTTTCTTATTGTGTTTCTGAGG - Intergenic
1044609519 8:94078322-94078344 ATTTTCTCATGGTGTCTAGGGGG + Intergenic
1045467329 8:102482350-102482372 GATTTCTCAGTATGTCTATGAGG + Intergenic
1045663077 8:104458132-104458154 GTGTTCACATTGTTGCTCTGAGG - Intronic
1046211965 8:111087780-111087802 GTATTCTCAGTGTGTCTATGAGG - Intergenic
1046324434 8:112621957-112621979 TATTTCTCATTCTCTCTCTGTGG + Intronic
1046526384 8:115386720-115386742 GTTTTATCACAGGGTCTCTGTGG + Intergenic
1046673648 8:117084932-117084954 GGTTTGTATTTGTGTCTCTGAGG + Intronic
1047652190 8:126934800-126934822 GTTTTCTAATTGTGTTTCATTGG - Intergenic
1047814668 8:128449919-128449941 GGTTTCTCATTGTGTTTCATGGG - Intergenic
1048129824 8:131683036-131683058 TTTTTCTCATTGTGTATTTTTGG + Intergenic
1048673106 8:136745475-136745497 TTTTTCTCATTGTGTCTTCTTGG + Intergenic
1051096022 9:13466043-13466065 GTTTTCTCTGTGTGTGTGTGGGG + Intergenic
1051319350 9:15884039-15884061 GTTTTCTTTTTGTGTGTATGTGG + Intronic
1052330501 9:27262576-27262598 GTTTTCTCATTCTGAATATGAGG - Intergenic
1052364173 9:27593134-27593156 GTTTTTTCATTCTGTTTATGTGG - Intergenic
1052836639 9:33255010-33255032 GTTTTCTCCTTCTGTCTCTGTGG - Exonic
1053286612 9:36853585-36853607 GCTTTCTCTCTGTGTCTTTGAGG - Intronic
1053461858 9:38277630-38277652 ACTTTCTCACTGTGCCTCTGGGG - Intergenic
1054976646 9:71154398-71154420 GTTATCTCATTTTATATCTGAGG - Intronic
1055223195 9:73963858-73963880 TATTTCTGAGTGTGTCTCTGAGG + Intergenic
1055583779 9:77734573-77734595 GTTTTATCACAGTTTCTCTGGGG - Intronic
1055617682 9:78090165-78090187 GTTTTCTTACTGAATCTCTGTGG + Intergenic
1055775035 9:79758576-79758598 TTTTTCTCTTTTTGCCTCTGTGG - Intergenic
1055800247 9:80027402-80027424 GTTCTCTCATTGTGTCACCATGG + Intergenic
1057215160 9:93223887-93223909 GTCTTCCCAGTGTGTCCCTGTGG + Intronic
1058429233 9:104903563-104903585 GTTCTCTCATTTTTTCTTTGTGG - Intronic
1059410636 9:114130173-114130195 GCTTTCTGGGTGTGTCTCTGGGG - Intergenic
1059648944 9:116296526-116296548 GTTTCCTCACTGTCTGTCTGTGG - Intronic
1059932490 9:119274673-119274695 ATTTTCTTATTTTGTCTCTGGGG - Intronic
1060373486 9:123097595-123097617 GTATTCTCATTGTGACCCTGGGG + Intronic
1062188323 9:135230358-135230380 CTTATCTCATTGTGTCTCCCCGG - Intergenic
1203751153 Un_GL000218v1:81734-81756 GTATTTAAATTGTGTCTCTGTGG - Intergenic
1203482833 Un_GL000224v1:22622-22644 GTATTTAAATTGTGTCTCTGTGG + Intergenic
1203709842 Un_KI270742v1:87764-87786 GTGTTTAAATTGTGTCTCTGTGG - Intergenic
1203541230 Un_KI270743v1:89779-89801 GTGTTTAAATTGTGTCTCTGTGG + Intergenic
1185579647 X:1202213-1202235 TGTTTCTCTCTGTGTCTCTGAGG - Intronic
1185667680 X:1779889-1779911 GTTCTCTCTGTGTGTCTCTTTGG + Intergenic
1185670782 X:1807705-1807727 CTTTTCTCACTGAGTCTCAGGGG - Intergenic
1185779525 X:2832310-2832332 GTCTTGTCATTGTGTGACTGTGG + Intronic
1186362969 X:8862037-8862059 ATTCTCCCTTTGTGTCTCTGTGG + Intergenic
1188454813 X:30351882-30351904 GGTATCTCATTGTGTCATTGTGG + Intergenic
1188631837 X:32373021-32373043 GTTCTCCCATTCTTTCTCTGTGG + Intronic
1188882411 X:35505740-35505762 GTTCTTTCATTCAGTCTCTGTGG - Intergenic
1189129118 X:38480093-38480115 GTTTTCTCATTGTGTCTCTGTGG + Intronic
1189499990 X:41547399-41547421 TTTTTCTGACTGTGTCCCTGTGG + Intronic
1190293178 X:49006789-49006811 GTTTTATCATTGATTCTCTAGGG + Intergenic
1190381952 X:49847676-49847698 GTCTTCTCATTGTATCTCACAGG + Intergenic
1190930497 X:54945531-54945553 TTTTTCTCAGGGTGTCTGTGAGG - Exonic
1192064598 X:67868243-67868265 GTTTTCTGATTCTGTCAGTGGGG + Intergenic
1192162914 X:68802044-68802066 GCTATCTTATTGTGTCTGTGTGG - Intergenic
1192771600 X:74197766-74197788 CTTTTCTCATTTTGTCTTTTTGG + Intergenic
1193045816 X:77052672-77052694 CTTTTCTCATTGTGTCTTTTGGG - Intergenic
1193105978 X:77672713-77672735 TTTTTCTCATAATTTCTCTGTGG - Intronic
1193355574 X:80516625-80516647 AATTTCTCATTGTGTTTCTGTGG - Intergenic
1194755669 X:97736248-97736270 TATTTCTCACTGTGTCTGTGAGG + Intergenic
1195800807 X:108707582-108707604 GTTTTCTTATAGTGTCTATCTGG + Intergenic
1195928381 X:110049217-110049239 GCCTTCTCATTGTGACTCTTGGG + Intronic
1196067337 X:111478635-111478657 GTGTTCACTTTGTGTCTCTGTGG - Intergenic
1196309213 X:114142109-114142131 GTGTTATCATGGTGGCTCTGTGG + Intergenic
1196989600 X:121313515-121313537 ATTTTCTCACTGTCTTTCTGTGG + Intergenic
1198056742 X:133003161-133003183 TTTTTCACATGCTGTCTCTGTGG - Intergenic
1198472329 X:136959103-136959125 TTTTTTTCATTGTGTATGTGGGG - Intergenic
1198488652 X:137115154-137115176 GTGTTCTCATTGCTTCTATGGGG + Intergenic
1200406126 Y:2813255-2813277 GTATTCTCAATGTGTCTCTCAGG - Intergenic
1200923900 Y:8637419-8637441 ATATTCTCATTGTGGTTCTGAGG + Intergenic
1201164807 Y:11199340-11199362 GTATTTAAATTGTGTCTCTGTGG - Intergenic
1201290504 Y:12417661-12417683 GTCTTGTCATTGTGTGACTGTGG - Intergenic
1201313801 Y:12622934-12622956 GTTTTTTAATTGTGTTTATGGGG - Intergenic
1201499992 Y:14631299-14631321 TTTTTTTCATTGTTTCTTTGTGG - Intronic
1202141073 Y:21723297-21723319 ATTTTCTCATTGTGGGTGTGGGG + Intergenic
1202145792 Y:21780501-21780523 ATTTTCTCATTGTGGGTGTGGGG - Intergenic
1202380563 Y:24273660-24273682 GTTTTCTCATTGTGGGTATTGGG + Intergenic
1202490221 Y:25396465-25396487 GTTTTCTCATTGTGGGTATTGGG - Intergenic