ID: 1189130855

View in Genome Browser
Species Human (GRCh38)
Location X:38496595-38496617
Sequence CTGTAGACAGAGCTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 426}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189130846_1189130855 14 Left 1189130846 X:38496558-38496580 CCTCCACTCTTGACTCCAATCTA 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426
1189130844_1189130855 28 Left 1189130844 X:38496544-38496566 CCAGCCTTGTGTCACCTCCACTC 0: 1
1: 0
2: 1
3: 19
4: 296
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426
1189130848_1189130855 -1 Left 1189130848 X:38496573-38496595 CCAATCTAGCTTTGCCCTACCGC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426
1189130843_1189130855 29 Left 1189130843 X:38496543-38496565 CCCAGCCTTGTGTCACCTCCACT 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426
1189130845_1189130855 24 Left 1189130845 X:38496548-38496570 CCTTGTGTCACCTCCACTCTTGA 0: 1
1: 0
2: 1
3: 18
4: 204
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426
1189130847_1189130855 11 Left 1189130847 X:38496561-38496583 CCACTCTTGACTCCAATCTAGCT 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG 0: 1
1: 0
2: 3
3: 50
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189130855 Original CRISPR CTGTAGACAGAGCTGGGGCC AGG Intronic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900244204 1:1630127-1630149 TTGGAGGCAGAGGTGGGGCCCGG - Intronic
900345196 1:2207192-2207214 CTGCTGGCAGAGCTGGGTCCTGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900952429 1:5865455-5865477 CAGGAGGCAGAGCTAGGGCCTGG + Intronic
901647120 1:10722808-10722830 CTCTAGGAAGAGCTGGCGCCAGG + Intronic
902110486 1:14074372-14074394 ATGTAGACAGATCTTGGGCATGG - Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902379037 1:16044019-16044041 CTGTGGCCTGAGCTGGGGTCAGG + Intronic
902500376 1:16907135-16907157 TGGTCGCCAGAGCTGGGGCCTGG + Intronic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
903163889 1:21508074-21508096 TTGGAGCCAGAACTGGGGCCTGG - Intergenic
903177545 1:21590011-21590033 CTGTAGATGGACCTGGGGCCTGG + Intergenic
903516068 1:23911837-23911859 GTGGTTACAGAGCTGGGGCCAGG + Intronic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905032867 1:34899557-34899579 CTGTGGAGAGAGCTCAGGCCTGG - Intronic
905473249 1:38208362-38208384 TTGTGACCAGAGCTGGGGCCTGG + Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906210760 1:44011163-44011185 CTGAAGAGGGAGCTAGGGCCAGG + Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
909392500 1:75133350-75133372 CTGCTGACCGAGCTGGGGTCTGG + Intronic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
912500992 1:110121739-110121761 TTGGTGACAGAGTTGGGGCCAGG + Intergenic
912572436 1:110634333-110634355 CTGGAGACCAAGGTGGGGCCAGG - Intergenic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
914437462 1:147672365-147672387 CCATAGACAGAGCAGGGGCATGG - Intergenic
914941182 1:152024211-152024233 CGGTGGAGAGAGGTGGGGCCGGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
917107656 1:171509595-171509617 CTGTATACAAATCTGGGGGCAGG - Intronic
917437557 1:175036526-175036548 CTGTAGTCCATGCTGGGGCCTGG + Intergenic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
919660929 1:200245639-200245661 ATCAAGCCAGAGCTGGGGCCAGG - Intergenic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
920690040 1:208139288-208139310 TTGAAGTCAGAGATGGGGCCAGG + Intronic
921669665 1:217912132-217912154 CTGGAGACAGACATGGGGTCGGG + Intergenic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
1063370971 10:5523098-5523120 CTGTGGACAGAGCTGTAACCTGG + Intergenic
1066353416 10:34658721-34658743 CTTTAGAGGGAGCTGGAGCCTGG - Intronic
1067068614 10:43117225-43117247 CTGTTCACAGGGCTGGGGCCTGG - Intronic
1067210574 10:44257627-44257649 CTATAGGGAGAGCTGGGACCTGG + Intergenic
1067409927 10:46055377-46055399 CTGTAAAGAGAGCAGGGGCTTGG - Intergenic
1067554895 10:47261881-47261903 AGGTAGACAGAGCAGGAGCCAGG - Intergenic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069892151 10:71658683-71658705 GTGTAGAAGAAGCTGGGGCCCGG + Intronic
1071223784 10:83501431-83501453 CTATAGAAAGAGCTGTGGCCAGG + Intergenic
1072006021 10:91248284-91248306 ATATAGAGAGAGCTGGGGACTGG + Intronic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1072722922 10:97791959-97791981 CTGTAGGTAGGGCTGAGGCCAGG + Intergenic
1073023850 10:100471286-100471308 CTGTAGGCAGAGGTGGGGAGGGG - Intronic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073191111 10:101651192-101651214 CCGCTCACAGAGCTGGGGCCTGG - Intronic
1073205995 10:101769719-101769741 CTGTGGTCAGAGCTGGCACCTGG + Intergenic
1074910663 10:117905687-117905709 CTGCAGACAGAGCTCAAGCCTGG + Intergenic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075942557 10:126404070-126404092 CTGGAGGCAGAGCGAGGGCCAGG - Intergenic
1076076018 10:127534451-127534473 CTGTGGACAGAGCTGTGGATGGG - Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076679996 10:132166867-132166889 CTGAAGACAGAGCTGTTGGCAGG - Intronic
1077073251 11:687432-687454 CTGTGAACTGAGCTGAGGCCTGG - Intronic
1077084430 11:741618-741640 CCATAGGCAGAGCAGGGGCCTGG + Intergenic
1077360577 11:2138765-2138787 CGGGAGAAAGAGCGGGGGCCGGG + Intronic
1077875189 11:6298805-6298827 CTGTTCACAGAGCTGCAGCCTGG - Intergenic
1078365274 11:10701212-10701234 CTGTAGACAGTTCAGGGTCCGGG + Intergenic
1078561989 11:12380235-12380257 CTATTGACAGAGCTGTGGGCAGG + Intronic
1078643148 11:13114504-13114526 CCTGAAACAGAGCTGGGGCCAGG - Intergenic
1078658111 11:13261174-13261196 CCGCAGACAGAGCTGAGCCCTGG + Intergenic
1079559201 11:21801862-21801884 TTGTAGAGAGAGCAGGGGCAGGG + Intergenic
1080614347 11:33932986-33933008 CTCATGACAGAGGTGGGGCCTGG - Intergenic
1082922666 11:58512418-58512440 CTGTAGACAGAGCTGGGTTTGGG - Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083446020 11:62708521-62708543 CTGTAGAGAGAGCTGTCCCCAGG + Intronic
1083712017 11:64555330-64555352 CTGAAGCCAGATGTGGGGCCTGG - Intergenic
1083741478 11:64713729-64713751 CTGAAGCCTGAGCGGGGGCCGGG - Exonic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085689397 11:78653108-78653130 CTCTTGACAGAGCTGCAGCCTGG + Exonic
1086076723 11:82862569-82862591 GTGTAGATAGAGCTGGGTGCAGG - Intronic
1087118270 11:94545662-94545684 CTGTACAGAGGGCTGGGGACCGG + Exonic
1089143334 11:116305838-116305860 CTGGAGACATAGGTTGGGCCAGG + Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089751433 11:120654154-120654176 CTGTAGTCAAAGCAGGGGCCTGG + Intronic
1090349080 11:126095741-126095763 CTGGAGACAGATCTGGGGTGAGG + Intergenic
1090387328 11:126364666-126364688 CTGGAACCAGGGCTGGGGCCTGG - Intronic
1090389892 11:126381864-126381886 CTGGAACCAGGGCTGGGGCCTGG - Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1092141143 12:6184324-6184346 TTGCAGACAGAGGAGGGGCCAGG - Intergenic
1093426963 12:19038500-19038522 CTGTAGCCAGAACTTGGCCCTGG - Intergenic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1095399318 12:41796253-41796275 CAGTAGGCAGAGCTCTGGCCTGG - Intergenic
1096181558 12:49553949-49553971 CTGTAGGTAGAGATAGGGCCTGG + Intronic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1096498161 12:52050632-52050654 CTGTTGGCCGAGCTTGGGCCTGG + Intronic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1097023110 12:56034762-56034784 GTGTAGACAGAGCTGATGACAGG - Exonic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101755441 12:107617559-107617581 CTCTGGCCAGACCTGGGGCCTGG - Intronic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1103321985 12:120097455-120097477 AGGTAGAAAGAGCTGGGCCCCGG - Intronic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103906141 12:124328108-124328130 CTCAAGCCAGAGCTGGGGGCTGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104822307 12:131684170-131684192 CCCTCGGCAGAGCTGGGGCCTGG - Intergenic
1106109697 13:26765994-26766016 GTGAGGACAGAGCAGGGGCCGGG + Intergenic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1108062167 13:46544299-46544321 CTGTAGTCAGAGCTGGTCCAAGG - Intergenic
1110793668 13:79612762-79612784 CTGTACACAGTGGTGGGCCCTGG + Intergenic
1113518966 13:110924766-110924788 CAGCAGACAGAGCTGGGTCCAGG - Intergenic
1113884599 13:113651986-113652008 CAGGAGGCAGAGCTGGGGCGGGG + Intronic
1114258791 14:21023470-21023492 CTGGAAACGGAGCTGGGGGCAGG - Intronic
1115437373 14:33390567-33390589 CTGTAGAGAGAGATGAGGGCAGG + Intronic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118592224 14:67410334-67410356 CTGTTGATATAGCTGGGCCCTGG - Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1121075131 14:91061098-91061120 CCGTGGACAGAGGAGGGGCCTGG + Intronic
1121333257 14:93061191-93061213 CTCAACACAGATCTGGGGCCAGG + Intronic
1122378750 14:101286727-101286749 CTCTAGTCAGAGCTGGGGGTGGG - Intergenic
1122830374 14:104392889-104392911 CTGTGGACAGGGCAGAGGCCCGG + Intergenic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1122997876 14:105275381-105275403 CTGTCCCCAGAGCTGAGGCCTGG + Intronic
1123508564 15:20971952-20971974 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123565786 15:21545701-21545723 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123602048 15:21982988-21983010 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1124598988 15:31115883-31115905 GTGTAGGCAGATTTGGGGCCTGG + Intronic
1124964418 15:34422785-34422807 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1124981037 15:34569011-34569033 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1127257314 15:57303234-57303256 ATGAAGACAGAGGTGGGTCCTGG - Intergenic
1127362923 15:58260827-58260849 GTGTGGACAGAGCTGGGACTGGG + Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1128525933 15:68412316-68412338 CATTAGGCAGAGCTGGGCCCGGG + Intronic
1129048555 15:72758497-72758519 CTGTTGAGAGAGCTGAGCCCAGG + Intronic
1129064905 15:72893839-72893861 ATGTAGAAAGAGATGGGGGCTGG - Intergenic
1130394961 15:83493786-83493808 CTGGAGACAGAGGTCAGGCCAGG + Intronic
1130938876 15:88491443-88491465 CTGGAAACAGGGCTGAGGCCAGG + Intergenic
1132309518 15:100847020-100847042 CTGAAGAGAGAGCTGGTCCCTGG + Intergenic
1202974155 15_KI270727v1_random:272794-272816 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134322237 16:13174515-13174537 CTGGAGACAGAACTGGGGGCAGG + Intronic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135051577 16:19197222-19197244 GTGTGGCCAGAGCTGGGCCCAGG + Intronic
1135075162 16:19386903-19386925 AAGTAGTCAGAGCTGGGGCCAGG - Intergenic
1135424361 16:22324969-22324991 CAGGAGCAAGAGCTGGGGCCTGG + Intronic
1135600793 16:23781851-23781873 CAGAAAACAGAGTTGGGGCCAGG - Intergenic
1135644813 16:24152587-24152609 TTCCAGAGAGAGCTGGGGCCGGG - Intronic
1135667847 16:24351030-24351052 CAGGAGACAGAGCTGGCCCCTGG - Intronic
1136240018 16:28937870-28937892 CTGGTGTCAGAGCTGAGGCCAGG - Intronic
1136654120 16:31699588-31699610 CTGTAGACAGATCTGAAGTCAGG + Intergenic
1137014560 16:35362218-35362240 CTGAAGACGGAGCAGAGGCCAGG - Intergenic
1138094283 16:54199951-54199973 CAGCTGACAGAGCAGGGGCCGGG + Intergenic
1138155150 16:54696159-54696181 CAGCAGACATAGCTGGGCCCTGG - Intergenic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139160283 16:64497860-64497882 TAGTAGACAGAGCAGGAGCCTGG + Intergenic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1140465139 16:75175226-75175248 CTGTAGACTGAGGTGAGGCAAGG - Intergenic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141298226 16:82789959-82789981 CAATAGACAGAGATGGGGGCTGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141440924 16:84029140-84029162 CTGCAGTCAGACCTGAGGCCTGG - Intronic
1141503857 16:84462243-84462265 CTGAAGACAGAGCCGGCCCCTGG - Intronic
1141805682 16:86340058-86340080 CTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1141846573 16:86613344-86613366 CCCTGGACAGTGCTGGGGCCAGG + Intergenic
1142108295 16:88317999-88318021 CAGAGGACAGGGCTGGGGCCAGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142286883 16:89175127-89175149 CTGTGGACAGGCCTGGGCCCAGG + Intronic
1142336935 16:89495369-89495391 CTGACCACAGAGCTGAGGCCAGG - Intronic
1142425374 16:89999721-89999743 CTGTGGTCAGAGCTAGGGTCAGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143993718 17:10988924-10988946 CTTTAGAAAGTGCTGGGGGCAGG + Intergenic
1144440228 17:15274599-15274621 CTGTAGAAAGAGCTGAGGAGGGG + Intergenic
1144634932 17:16899588-16899610 TAATAAACAGAGCTGGGGCCGGG - Intergenic
1144713830 17:17420787-17420809 ATGTTGAAAGAGCAGGGGCCTGG - Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1145017665 17:19409776-19409798 CTGAAGGCAGAGCTGTGGCACGG + Intergenic
1145037451 17:19551264-19551286 CTCAGGACAGGGCTGGGGCCAGG - Intronic
1145168986 17:20638816-20638838 TAATAAACAGAGCTGGGGCCGGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978592 17:37138355-37138377 AGGAAGACAGAGCTGGGCCCTGG - Intronic
1148239726 17:45992362-45992384 CTGGAGACAGAGCAGCAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1149566667 17:57645188-57645210 CTGTGGGCAGGGTTGGGGCCAGG + Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150330822 17:64292951-64292973 AGGAAGACAGATCTGGGGCCTGG - Intergenic
1150576213 17:66433269-66433291 CCGGGGCCAGAGCTGGGGCCGGG - Intronic
1150644119 17:66967514-66967536 AAGTAGCCAGAGCTGAGGCCTGG + Intronic
1152337531 17:79707017-79707039 GAGGAGACAGAGCTGGAGCCAGG + Intergenic
1152376014 17:79919400-79919422 CTGTAGAGAGAGGTGGTTCCTGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1157555555 18:48610782-48610804 ATGGAAACAGAGCTGGGGCTTGG - Intronic
1157808994 18:50679807-50679829 CTGTGAGCAGAGATGGGGCCAGG + Intronic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1158001609 18:52625989-52626011 CTGTAAACAGAGCTGGCTCTGGG + Intronic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158144720 18:54299137-54299159 CTGTTGACAGAGCCTGGGCCGGG + Intronic
1158306069 18:56107001-56107023 CTGAAGACTGAACTGGGGCCCGG + Intergenic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160513738 18:79467022-79467044 CTGTAAACAGAACTGGGACCGGG - Intronic
1161573214 19:5041487-5041509 CTGAGGCCAGAGGTGGGGCCAGG - Intronic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1162557113 19:11394154-11394176 ATGTAGAAAGAGGTGGGGCATGG - Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163025011 19:14505797-14505819 AGGAAGACAGAGCTGGGACCTGG - Intergenic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163478800 19:17542454-17542476 TGGTGGACAGAGCTGGGGCAGGG + Intronic
1163535591 19:17874471-17874493 CTGTAGACAGAGTGTGGGGCGGG - Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165905793 19:39193915-39193937 GTGTAGTCAGAGCTGTGCCCAGG - Intergenic
1166122794 19:40695506-40695528 CTGTAGACAGAGTTGCCCCCAGG + Intronic
1166305106 19:41932914-41932936 CTGGAGACAGATGTGGGGGCTGG + Intergenic
1166318527 19:42002528-42002550 CTGGATGCAGAGCTGGGGTCTGG + Intronic
1166355424 19:42224689-42224711 CTGGAGCCGGAGCTGGTGCCGGG + Exonic
1167154333 19:47729163-47729185 GTGTGGTCAGAGCTGGGGCGGGG + Intronic
1168331599 19:55573136-55573158 CTGAAGACAGTGCTTGGGCCTGG - Intergenic
1168694908 19:58398588-58398610 CTCTAGACAGTCCTGGGCCCAGG - Intergenic
926134048 2:10324367-10324389 CTGGAGTCAGGTCTGGGGCCAGG + Intronic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
926905555 2:17802007-17802029 GTAAAGTCAGAGCTGGGGCCTGG - Intergenic
927719134 2:25372083-25372105 CTGTAGACCGGGCTGGGGTAAGG + Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
928200316 2:29243626-29243648 CTTTACACAGAGGTGGGCCCTGG - Intronic
928201194 2:29248608-29248630 CGCCAGACAGTGCTGGGGCCCGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928658682 2:33479216-33479238 CTATAGAGAGAGCTTGGGCTTGG - Intronic
929779305 2:44947454-44947476 CTTGACACAGAGCTTGGGCCTGG + Intergenic
931666764 2:64615372-64615394 GGCTACACAGAGCTGGGGCCAGG - Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932415664 2:71572591-71572613 CTGTGGCCTGAGCTGTGGCCTGG + Intronic
932418752 2:71589061-71589083 CTGAGGACAGAGGTGGGGACAGG - Intronic
932764430 2:74460991-74461013 CAGCAGACAGTGCTGAGGCCTGG + Intergenic
932885546 2:75546083-75546105 CTGTTGAGGGGGCTGGGGCCAGG + Intronic
933721197 2:85398689-85398711 CCTTATACAGAGCTGCGGCCTGG + Exonic
934747627 2:96769947-96769969 CAGCTGACAGAGCTGTGGCCAGG + Intronic
935216480 2:100978924-100978946 CTGAAGTCAGAGCTCAGGCCTGG - Intronic
936242141 2:110797059-110797081 CTGTATTCAGAGCTGGCACCAGG + Intronic
938732641 2:134158477-134158499 CTGAAATCAGAGCTGGTGCCGGG + Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939090106 2:137770307-137770329 CTGTTGATAGTGCTGGGGCCAGG - Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
946357818 2:219199649-219199671 CTCTAGCCAGAGGCGGGGCCTGG - Intronic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
947660449 2:231862460-231862482 CTGTAGAGAGAACTGGGCCAAGG + Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948343211 2:237271876-237271898 CTGTGAACAGAGCTGTGACCTGG + Intergenic
948422874 2:237871263-237871285 CTTTAGACAGAGCAGGGGCAGGG + Intronic
948459769 2:238123537-238123559 CTGTCCACAGAGCAGGGGCCGGG - Intronic
948893894 2:240919423-240919445 TTGGAGGCAGAGCAGGGGCCTGG - Intronic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1169111585 20:3037481-3037503 CTGTTGCCAGAGGTTGGGCCAGG + Intronic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1169200677 20:3707753-3707775 ATGGGGACAGAGCTGGGGGCAGG - Intergenic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1169916290 20:10686944-10686966 CTGGGGGCAGAGCTGGGGGCGGG - Intergenic
1170155025 20:13261619-13261641 CTGTGGAAAGGACTGGGGCCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172697631 20:36833417-36833439 CTGTTTACAGCGCTAGGGCCTGG + Intronic
1172909733 20:38399087-38399109 GTGTAGACAGAGCTGGGCGTGGG + Intergenic
1174124073 20:48289774-48289796 TTGAAGACAGAGGAGGGGCCGGG + Intergenic
1174282455 20:49449080-49449102 CTGGAGCCAGAGGTGAGGCCAGG - Intronic
1174401384 20:50277891-50277913 TTGTAGGCAGGGCTGTGGCCAGG + Intergenic
1174549242 20:51349784-51349806 CTGTAGACTGCGCTGGGGAGAGG + Intergenic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175572755 20:60036661-60036683 CTGTAGATAGGGGTGGGGACAGG - Intergenic
1175811095 20:61857558-61857580 ATGTGGAGGGAGCTGGGGCCTGG + Intronic
1175902638 20:62366186-62366208 CTGTAGACTTAGGTTGGGCCTGG - Intronic
1179039702 21:37791410-37791432 CTGCACATTGAGCTGGGGCCAGG + Intronic
1179405461 21:41122097-41122119 CTGTCGAGAGGGCTGAGGCCAGG - Intergenic
1179679818 21:43011362-43011384 CTCAAGACAGAGCTGTCGCCGGG - Intronic
1180730113 22:17974956-17974978 TAGAAGACAGAGCTGGGCCCAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181442918 22:22946886-22946908 GTGTAAACAGGGCTGGGGGCGGG - Intergenic
1181443296 22:22949710-22949732 CAGGAGACAGAGCAGGGACCTGG - Intergenic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1184043169 22:41956558-41956580 CTGCAGTCAGGGCTGGGCCCCGG + Intergenic
1184596552 22:45517456-45517478 CTGTAGCCTGGGCTGGGGCATGG + Intronic
1184989960 22:48160767-48160789 GTGTTGGCAGGGCTGGGGCCTGG + Intergenic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949948760 3:9211969-9211991 ATTAAGACAGAGCTGAGGCCGGG - Intronic
949953505 3:9248688-9248710 CTGCAGATAGCGCTGGGGCTGGG - Intronic
950462723 3:13134994-13135016 CAGGAGGCAGAGCTCGGGCCTGG + Intergenic
950695872 3:14700892-14700914 CTGCTGACAGTTCTGGGGCCAGG + Intronic
951356400 3:21672147-21672169 CTGTTGACAGAGATGGGAACTGG - Intronic
952691528 3:36211881-36211903 CCCAAGACAGAGCTGTGGCCAGG - Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953448354 3:42986611-42986633 CTGGAGATGGGGCTGGGGCCAGG + Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
953877724 3:46675960-46675982 CTGTAGGCTGAGCTTGGCCCTGG - Intronic
953915070 3:46913892-46913914 CTGTGGACAGGGTTGGAGCCAGG + Intergenic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
959378041 3:105608840-105608862 GTGTTGAAAGAGCAGGGGCCTGG + Intergenic
961213783 3:125144451-125144473 CTGTGGGCTGGGCTGGGGCCAGG - Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
962929209 3:140021953-140021975 CGGCAGACAGAACTGGGACCTGG + Intronic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
964620706 3:158717715-158717737 ATGTAGACAGAGCAGGAGGCTGG + Intronic
965016310 3:163161956-163161978 CTTTTAATAGAGCTGGGGCCAGG + Intergenic
965258970 3:166455502-166455524 CTGTAGGCAGAGCAGTGGGCTGG + Intergenic
966769011 3:183487248-183487270 CTGTAAGAAGAGCTGAGGCCAGG + Intergenic
968232544 3:197012209-197012231 GTGAAGACAGGGCTGTGGCCTGG + Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968679321 4:1905768-1905790 ATGGAGACAGAGCTGAAGCCAGG - Intronic
968787218 4:2631535-2631557 CTGTAGACAGAGCTGGTATTAGG + Intronic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
969172760 4:5377031-5377053 CTGTGGGGAGAGCTGGGGGCAGG - Intronic
969570008 4:8002668-8002690 CTGTAGACAGGTCTGGAGGCAGG - Intronic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973317976 4:48780794-48780816 ATGTATCCAGAGCTGGCGCCCGG + Intergenic
974091505 4:57316026-57316048 CTGTAGAGGTAGATGGGGCCAGG + Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
976097890 4:81528391-81528413 CTGAAATCAGAGCTGGTGCCAGG + Intronic
977284439 4:95084979-95085001 CTATTGAAAGAGCTGGTGCCCGG + Intronic
977655169 4:99513356-99513378 CTGTAGTGAGAGCAGAGGCCTGG + Intronic
981594128 4:146399991-146400013 CTGTAGACAGAGTAAAGGCCAGG + Intronic
984704747 4:182839555-182839577 CTTTAGACAGAGCTTGGACCTGG - Intergenic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
985609888 5:881576-881598 CTGTACACAGAACTGGGGTGTGG - Intronic
986004388 5:3656114-3656136 GAGGAGACAGAGCAGGGGCCTGG + Intergenic
986068892 5:4263281-4263303 CTGTAGCAGGAGCTGGGGTCTGG - Intergenic
990439680 5:55832234-55832256 TTGGAGGCAGAGGTGGGGCCTGG + Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
991667575 5:69014519-69014541 TTGAAGACAGAGGTGGGGCTGGG - Intergenic
992075289 5:73187218-73187240 GTGAAGACAGTGCTGGGCCCTGG - Intergenic
992342886 5:75844302-75844324 CTGCTGAAAGAGCTGGGGGCTGG - Intergenic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
996289535 5:121835450-121835472 CTGAAGACAGAATTCGGGCCAGG - Intergenic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998132079 5:139656277-139656299 CTGTGGCAAGAGCAGGGGCCAGG - Intronic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998165226 5:139838842-139838864 CTAGAGACAGAGCTGGGGTGGGG - Intronic
998406827 5:141878754-141878776 GGGCAGACAGAGCTGGGGACAGG - Intronic
1001666608 5:173438400-173438422 GTGCAGACAGATCAGGGGCCAGG + Intergenic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1002603918 5:180370844-180370866 CTGCAGGCAGGGCAGGGGCCAGG + Intergenic
1002927223 6:1611508-1611530 CTGTAGAGGGAGCTCTGGCCGGG - Exonic
1003454653 6:6270650-6270672 GTGGAGACAGAACTGGGGACAGG + Intronic
1003486163 6:6581415-6581437 GTGCAGACTCAGCTGGGGCCAGG - Intergenic
1005634806 6:27743386-27743408 CTGTCGATTGAGATGGGGCCAGG - Intergenic
1005824393 6:29623930-29623952 GTGGAGACAGAGCTGCAGCCAGG + Exonic
1006679709 6:35788155-35788177 CTGCCCACAGAGTTGGGGCCTGG + Intronic
1006997204 6:38272375-38272397 CAGTAGACAGAGCTGGCAACAGG - Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007419796 6:41712683-41712705 CTGTTGATAGAGCCGGTGCCAGG + Intronic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1007650467 6:43417267-43417289 GTGTAGCTAGAGCTGGGGCTGGG - Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1007719858 6:43878521-43878543 CTGTACACTGTGCTGGGTCCTGG - Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1014247744 6:119084914-119084936 CTGGAGACAGAGCAGGGAGCAGG + Intronic
1014882587 6:126741923-126741945 CTGAACACAGGGCTGGGGACTGG + Intergenic
1015262600 6:131255622-131255644 CTGTAGACAGAGCACAGGCCTGG + Intronic
1017419199 6:154256162-154256184 ATGTGGGCAGAGCTGGTGCCTGG + Intronic
1018701562 6:166431369-166431391 CTGCAGACTGAGGTGGGGCCTGG + Intronic
1019165228 6:170094107-170094129 CTGCAGAGAGGCCTGGGGCCAGG - Intergenic
1019298006 7:289432-289454 CTGCAGAAAGCGCTGGGACCTGG + Intergenic
1019342034 7:512871-512893 CCCCAGACAGAGGTGGGGCCTGG - Intronic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1019924011 7:4180501-4180523 CTGGACATAGAGCTGGAGCCAGG - Intronic
1020717969 7:11701987-11702009 CTGTGGTCAGAGTTGAGGCCTGG - Intronic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1024795419 7:53013793-53013815 CTCTACACAGAGCTGCTGCCAGG - Intergenic
1024924476 7:54598760-54598782 CTGCAGAGAGGGCTGGAGCCTGG - Intergenic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026302024 7:69106440-69106462 CTGTAGGCAGAGCAGCGGCATGG + Intergenic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1026899334 7:74028286-74028308 CTGTGGGCAGCGCTGGGGACAGG - Intronic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1029659200 7:101948043-101948065 CTGTTAACAGAGCGGGGGCAGGG - Intronic
1031010916 7:116525179-116525201 GTGGAGAGAGGGCTGGGGCCAGG - Intronic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031074618 7:117200442-117200464 CTGTAGACAGAGCTGCTGAGGGG + Intronic
1031665555 7:124478711-124478733 CTAGAGACAGAGCTTCGGCCAGG + Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032165441 7:129541348-129541370 CTGGAGAAAGGGCTGTGGCCTGG + Intergenic
1032288695 7:130566615-130566637 CTGTAAGCAGAGGTGGGCCCTGG - Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1034259835 7:149748106-149748128 CTGCAAAGAGAGCTGGGGGCGGG + Intergenic
1034535108 7:151721368-151721390 CTGAAGACAGGGCCAGGGCCAGG + Intronic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1035328729 7:158082896-158082918 CCGTAGACAGGCCTGGGGCCTGG - Intronic
1036511718 8:9406509-9406531 CCTTAGTCAGAGGTGGGGCCGGG - Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1046809353 8:118515873-118515895 CTGCAGAGAGGGCTGGGGACTGG - Intronic
1046902212 8:119535724-119535746 CTGTTGAATGAGCTGGGTCCTGG + Intergenic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1047301425 8:123616715-123616737 CTGTTGAAAGATCTGTGGCCAGG - Intergenic
1048048766 8:130797557-130797579 CTAGACACAGAGCTGGGCCCTGG + Intronic
1048256583 8:132909464-132909486 CTGAAGACAGAGATAGGGTCAGG + Intronic
1048460352 8:134616170-134616192 CTGTTGAGAGAGCTGGGTTCAGG - Intronic
1048692453 8:136982982-136983004 GAGTAGACAGAGCCTGGGCCTGG + Intergenic
1049344775 8:142132979-142133001 CAGATGACAGAGCTGAGGCCCGG - Intergenic
1049576872 8:143393640-143393662 CAGTGGACAGAGCTGAGGCCTGG - Intergenic
1049594100 8:143475613-143475635 CTGTAGTCTGTCCTGGGGCCAGG - Intronic
1049641608 8:143718509-143718531 CTGTGGTCAGAGCAGGAGCCTGG - Intronic
1049894463 9:100681-100703 CTGTGGGCAGAACTGGGGCGTGG - Intergenic
1050141979 9:2525463-2525485 CTGTAGGCAGAGCAGTGGCATGG - Intergenic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1052382352 9:27785161-27785183 CTGGAAACAGAGCTGAAGCCAGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1054692707 9:68330727-68330749 CTGTGGGCAGAACTGGGGCGTGG + Intronic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056154079 9:83817627-83817649 GTGTCGGCAGAGCTGGGGGCAGG + Exonic
1056205299 9:84314006-84314028 CAATAGGCAGAGCTGGGACCAGG + Intronic
1056356419 9:85805466-85805488 GTGTCGGCAGAGCTGGGGGCAGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059452821 9:114381372-114381394 CAGGAGACAGAGCTGCTGCCAGG + Exonic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060219486 9:121756858-121756880 CTTAAGACAGATCTGGGGGCAGG - Intronic
1060967187 9:127717838-127717860 AAGGAGACAGAGCTGGGCCCAGG - Intronic
1061138662 9:128751321-128751343 CTGGAGACTGAGCTGGGATCTGG - Intronic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061366196 9:130173303-130173325 TGGCAGACAGAGATGGGGCCAGG - Intronic
1061387732 9:130300347-130300369 CTGTAGACACAGCAGTGGGCAGG + Intronic
1061970699 9:134043581-134043603 CTGTCGGCCGAGCGGGGGCCTGG - Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062432665 9:136532959-136532981 CTGTCGGCAGCCCTGGGGCCAGG - Intronic
1187276017 X:17817195-17817217 CTGTGCACAGTGCTGGGGGCAGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189376622 X:40471669-40471691 ATATAGACAGAGAAGGGGCCGGG - Intergenic
1192151956 X:68718139-68718161 ATGTACCCAGACCTGGGGCCTGG + Exonic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1195108881 X:101625236-101625258 CTGGAACCAGAGCTAGGGCCAGG + Exonic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196495428 X:116318589-116318611 CTCTAGACCTACCTGGGGCCTGG + Intergenic
1197303003 X:124804080-124804102 CTTTATACTCAGCTGGGGCCAGG - Intronic
1199404928 X:147445525-147445547 CTGTAGACAGAGCAGCAGCATGG - Intergenic
1201911282 Y:19135776-19135798 TTGTAGGCAGAGCTGGGCCTTGG - Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic