ID: 1189131567

View in Genome Browser
Species Human (GRCh38)
Location X:38503289-38503311
Sequence TGATAGGCAATCAACTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189131567_1189131569 5 Left 1189131567 X:38503289-38503311 CCAATCAAGTTGATTGCCTATCA 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1189131569 X:38503317-38503339 AAATGAACTACATTCCCTACAGG 0: 1
1: 0
2: 2
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189131567 Original CRISPR TGATAGGCAATCAACTTGAT TGG (reversed) Intronic
902318530 1:15642620-15642642 TGATATAAAAACAACTTGATAGG + Intronic
908234946 1:62139672-62139694 TGATTGGCAAGTAACTTGATAGG - Intronic
908409066 1:63844447-63844469 TGCTAGACTATCAACTTTATGGG + Intronic
908628003 1:66068528-66068550 AGATAGAAAATCAACTTGATGGG - Intronic
911469956 1:98305967-98305989 AGCTAAGCAGTCAACTTGATGGG - Intergenic
921016330 1:211195391-211195413 TAATAGGCAATTAACTTGCTTGG - Intergenic
921525686 1:216214981-216215003 TGATAGTCATTCTTCTTGATAGG - Intronic
1063216278 10:3928937-3928959 TGATAGAAAGTCAACTTGTTGGG + Intergenic
1076196956 10:128525624-128525646 TGACATGCAATAAACTTGACGGG + Intergenic
1078206908 11:9238096-9238118 TGATATGAATTCAACTTGAGTGG + Intronic
1084900573 11:72307089-72307111 TAATAGGCAATCAAAAAGATGGG - Intronic
1087930089 11:103967091-103967113 TCAGAGGCAATCAACATTATTGG + Intronic
1098497775 12:71156197-71156219 GGATAGGTAATCAACTCCATTGG - Intronic
1103435030 12:120918588-120918610 TAACAGGCAATTAACTTGGTTGG + Intergenic
1110038676 13:70722263-70722285 TAACAGGCACTCAACTTGAGAGG + Intergenic
1110535079 13:76641940-76641962 TGGTAGGAAAACAACTTGAGAGG + Intergenic
1114288437 14:21267990-21268012 TGTAAGGCAATCTATTTGATAGG - Intronic
1115352636 14:32411657-32411679 TGAGAGTCAATCAAATTTATAGG - Intronic
1116719664 14:48479098-48479120 TGATGGTCAATTGACTTGATGGG + Intergenic
1118032285 14:61830343-61830365 TTAGAGGCAATCAACCTGCTTGG + Intergenic
1121478072 14:94232092-94232114 TAATAGGCAAACAACATGCTGGG - Intronic
1125004030 15:34798079-34798101 TGTTAGGCAATGAAATTGAGCGG - Intergenic
1126945667 15:53816829-53816851 GAATAGGAAGTCAACTTGATTGG + Intergenic
1127811753 15:62571059-62571081 TGATGATCAATCAACATGATTGG + Intronic
1130772396 15:86938005-86938027 TGATGGGCAACCAACTGTATTGG - Intronic
1139115978 16:63953427-63953449 TAATAGGCAATTAATTTGGTTGG + Intergenic
1149006043 17:51806435-51806457 TCATAGGCTATCAACTCGTTTGG + Intronic
1156954645 18:42947568-42947590 TGATAAGGACTGAACTTGATAGG + Intronic
1157884785 18:51356229-51356251 TGATAGATAATCAACTTAGTAGG - Intergenic
927834097 2:26377961-26377983 TGATAGGCATTTAACTTGTTTGG + Intronic
928630470 2:33186546-33186568 TGGTAGACAATCATCTTGAGTGG + Intronic
936934794 2:117828726-117828748 TGAAAGGCAAGGAACTGGATAGG - Intronic
942011112 2:171763281-171763303 TTATAGGCAAACAAAATGATAGG + Intergenic
943881607 2:193152504-193152526 TGATATGAAATTAACTTGATGGG - Intergenic
1169817820 20:9676745-9676767 TGATATGAAATCATCTTGATTGG + Intronic
1172133207 20:32669853-32669875 TGAAAGGCAATCTACTGAATGGG + Intergenic
1174715920 20:52758697-52758719 TGATAAGCAATCTACTTGTTTGG - Intergenic
1175437007 20:58960081-58960103 TAATAGGCAATTAACTTGCCTGG - Intergenic
1179578896 21:42325785-42325807 TGACAGGCAATCATCTCCATTGG - Intergenic
953727676 3:45414771-45414793 TGACAGCCCATGAACTTGATAGG + Intronic
959378062 3:105609011-105609033 TCATAGGCAAGCAACTGGAGTGG - Intergenic
966475371 3:180338714-180338736 TTATAGGTAATAAACATGATAGG + Intergenic
974300381 4:60058702-60058724 TGAAAGAAAATCAACTTAATAGG + Intergenic
974863673 4:67553655-67553677 TGAAAAGCATTCAACATGATTGG - Intergenic
977056139 4:92193680-92193702 TGAAAGGCAATATACTTTATAGG + Intergenic
982356812 4:154478821-154478843 TAGCAGGTAATCAACTTGATTGG - Intronic
982934660 4:161457153-161457175 TGATTGGCAAACAATATGATAGG - Intronic
989826248 5:45859807-45859829 TGATAGGCATTTAGGTTGATTGG - Intergenic
990319036 5:54611766-54611788 TGATGGGGAAGCAACTTGACTGG + Intergenic
990785805 5:59418299-59418321 TGAGAGGCAATCATGTAGATAGG - Intronic
993600759 5:89921701-89921723 TGGTAGGCATTTAACTTGATGGG - Intergenic
994699103 5:103111128-103111150 TGATAGGCAGGCAAATGGATGGG - Intronic
996789758 5:127280483-127280505 TGATGAGCACACAACTTGATGGG - Intergenic
998611296 5:143692235-143692257 TGAAAGGCTATCAACTTGCAAGG - Intergenic
1001634916 5:173202908-173202930 TGTTTGGGAAGCAACTTGATTGG - Intergenic
1005589289 6:27308726-27308748 TGATAGACATTCAACTTATTTGG + Intronic
1006366188 6:33616978-33617000 TGTTAGGAAATCAACTTAGTGGG - Intergenic
1010022514 6:71177201-71177223 TGTTAGGAAATCGGCTTGATAGG + Intergenic
1010903751 6:81459936-81459958 TGAAAGGCAATCAGGTTGAAGGG - Intergenic
1011352913 6:86442583-86442605 TCATAGTCAATATACTTGATAGG + Intergenic
1012011754 6:93796681-93796703 TGATAACCATTCTACTTGATGGG - Intergenic
1012235692 6:96811894-96811916 TAAAAGGCAATCACCTTCATTGG + Intronic
1012312693 6:97747665-97747687 TGAAAAGCAATTAACTTCATTGG + Intergenic
1017378935 6:153804661-153804683 TGATAGGTAATACAATTGATAGG + Intergenic
1018068235 6:160138715-160138737 TGATAGGCAATCTGCATGCTGGG + Intronic
1034643316 7:152622555-152622577 TGAAAGACAATCAAATTCATTGG - Intergenic
1034677895 7:152904764-152904786 TGTCAGGCAAGCAGCTTGATAGG + Intergenic
1035926264 8:3731086-3731108 TGCTCGACAATAAACTTGATTGG - Intronic
1042302933 8:67305291-67305313 ACATCTGCAATCAACTTGATAGG + Intronic
1044714829 8:95090649-95090671 TGAGTGTCAGTCAACTTGATTGG + Intronic
1048538465 8:135319867-135319889 TAGTAAGCAATGAACTTGATGGG + Intergenic
1053457719 9:38243645-38243667 TGATAGGGCATCAACTTGTGAGG + Intergenic
1060689481 9:125643965-125643987 TGCAAGACAATCAACTGGATAGG + Intronic
1203352907 Un_KI270442v1:96036-96058 TGATATGGAATCAACTCGATTGG + Intergenic
1187035487 X:15534458-15534480 TGATAGGCAAAAGACTTGAGAGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189131567 X:38503289-38503311 TGATAGGCAATCAACTTGATTGG - Intronic
1189675756 X:43458890-43458912 TGCTAGGCAATCAAGTGGAATGG - Intergenic
1190125830 X:47704672-47704694 TGCTAGGCAATCAAGTGGAATGG + Intergenic
1192868592 X:75163220-75163242 TTATAGGTAATTAACATGATTGG + Intergenic
1193135365 X:77965225-77965247 TGAAAGACAACCAACTGGATAGG + Intronic
1193242320 X:79185608-79185630 TGATAGTCAATGTACTTGGTCGG - Intergenic
1197018856 X:121661352-121661374 TGATGGGCACTTAAGTTGATGGG - Intergenic
1198412495 X:136385750-136385772 TAACAGGCAATTAACTTGGTTGG + Intronic
1198894121 X:141431794-141431816 TCTTATGCAATCAACTTTATCGG + Intergenic