ID: 1189135323

View in Genome Browser
Species Human (GRCh38)
Location X:38543177-38543199
Sequence CCCTCCATGTAGACAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189135320_1189135323 -2 Left 1189135320 X:38543156-38543178 CCTGCATTGTTTCAAGTTTTTCC 0: 1
1: 0
2: 1
3: 33
4: 298
Right 1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG 0: 1
1: 0
2: 0
3: 10
4: 93
1189135317_1189135323 29 Left 1189135317 X:38543125-38543147 CCACACTTACTCCCACAGGCTGA 0: 1
1: 0
2: 4
3: 20
4: 249
Right 1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG 0: 1
1: 0
2: 0
3: 10
4: 93
1189135318_1189135323 18 Left 1189135318 X:38543136-38543158 CCCACAGGCTGAGCAAAGCGCCT 0: 1
1: 0
2: 1
3: 15
4: 141
Right 1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG 0: 1
1: 0
2: 0
3: 10
4: 93
1189135319_1189135323 17 Left 1189135319 X:38543137-38543159 CCACAGGCTGAGCAAAGCGCCTG 0: 1
1: 0
2: 4
3: 20
4: 207
Right 1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189135323 Original CRISPR CCCTCCATGTAGACAATGGA TGG Intronic
900101865 1:965412-965434 CCCCCCATGCAGGCAGTGGAGGG - Exonic
900940153 1:5793366-5793388 CCCTCCAGGTAGCGCATGGAAGG + Intergenic
904092943 1:27957739-27957761 CCCTCCCTGAGGAGAATGGAGGG - Intronic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
910934287 1:92474887-92474909 CCCTCCATGTGTACCATAGAGGG - Exonic
921256067 1:213340760-213340782 CCCTCTATGTTGACAATGCTGGG + Intergenic
922182267 1:223244562-223244584 CCCTCAGTGTAGATAATGCAGGG + Intronic
1066432450 10:35364248-35364270 CCATCCGTCTAAACAATGGAAGG + Intronic
1068529120 10:58164820-58164842 CCCTCCAAGTTGACAATCCATGG + Intergenic
1068763302 10:60735446-60735468 CCAGCCAGGTAGACAATAGAGGG + Intergenic
1070977033 10:80613710-80613732 CCAGCCATGTAGACAGTGCAGGG + Intronic
1071714511 10:88081811-88081833 TCCTGCATGAAGACAATGGCTGG + Intergenic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1079343079 11:19629096-19629118 CACTCCACGGAGACAATGAATGG - Intronic
1081192267 11:40118693-40118715 CCCTCTATCAAGAGAATGGAAGG + Intronic
1085645974 11:78223141-78223163 CCCTGCATGTAGACCAGGCAAGG - Intronic
1085804303 11:79620486-79620508 CCATCCATGTAGGAACTGGATGG - Intergenic
1086912710 11:92491504-92491526 TTCTCCAAGCAGACAATGGAAGG + Intronic
1088197638 11:107293493-107293515 CCCTCCATGTATAAAAGTGATGG - Intergenic
1088704496 11:112449357-112449379 CCCTCCATGTAGGCTTTTGACGG + Intergenic
1091123196 11:133074021-133074043 GCATTCATGTAGAGAATGGATGG - Intronic
1091206296 11:133823541-133823563 CCCTCCATCTGGTCAGTGGAAGG + Intergenic
1102759158 12:115370300-115370322 CTCTCCATGTAGACTAAGCATGG - Intergenic
1107774862 13:43827757-43827779 CCCTCCATATAAACGAGGGATGG - Intronic
1113028200 13:105964481-105964503 ACTTCCAGGTAGAGAATGGAAGG - Intergenic
1114632007 14:24165058-24165080 TCCTCCATGTAGCCTATGCATGG + Intronic
1115850613 14:37587567-37587589 GCCATCATGTAGAAAATGGACGG + Intergenic
1120075538 14:80153525-80153547 CCGTCCAGGTAAACAATGCAGGG - Intergenic
1122387789 14:101360856-101360878 CCCACCATGTATGCAATGGCAGG + Intergenic
1126644919 15:50866300-50866322 ACTTCCATGAAGACAATAGAAGG + Intergenic
1128352508 15:66900589-66900611 TTCTCCATGTATACAATGAAAGG - Intergenic
1129004290 15:72359187-72359209 CCTTCCCTGTAAACAATGGCAGG + Intronic
1132473143 16:118035-118057 CCCTACCTGTAGGCAATGAAGGG - Intronic
1138462066 16:57155315-57155337 ACCTCAATCTAGACAATGCAGGG + Intronic
1140442550 16:74999018-74999040 GCCGCCGTGGAGACAATGGAGGG - Exonic
1141141972 16:81502406-81502428 GCCTCCATGTGAGCAATGGAGGG + Intronic
1141414388 16:83858927-83858949 CCCTCCAAGTGGACAGGGGAAGG + Intergenic
1142902004 17:3018082-3018104 CACTCCATGGAGACCATGGTGGG + Exonic
1144885116 17:18452401-18452423 CCCTCCATTTGGAGAGTGGATGG - Intergenic
1146364537 17:32210893-32210915 CCCTCCCTGTAGAAAATCTAGGG - Intronic
1146681554 17:34811847-34811869 CTCTCCATTTAGACAGTGCATGG - Intergenic
1147925903 17:43945733-43945755 TCCTCCTTTTAGACCATGGAGGG - Intergenic
1149596296 17:57866670-57866692 CCCCCCAGGTAGACGATGCATGG + Intronic
1152693341 17:81731844-81731866 GCAACCAAGTAGACAATGGAGGG + Intergenic
1152970312 18:155231-155253 CCCTCCATGTGTTTAATGGATGG - Intergenic
1159777756 18:72623307-72623329 CCCTCCCTGTGGAAAAAGGAGGG + Intronic
1159809505 18:72999460-72999482 CCCTCCATGTACACAACTGAAGG + Intergenic
1161373022 19:3924198-3924220 CCCTCCATTGAGTGAATGGATGG + Intronic
1166416122 19:42595932-42595954 CCCTCTGTGTAGAGAAAGGATGG + Intronic
1167718184 19:51157968-51157990 CCCTCCATCTAGACTGTGCACGG + Intergenic
1167764709 19:51473880-51473902 CCCTCCATCTAGACTGTGCATGG - Intergenic
928584319 2:32743100-32743122 CCCTCCACGTAAAAAATGAAGGG - Intronic
932691771 2:73919546-73919568 CACTTCCTGTGGACAATGGAGGG - Exonic
935676573 2:105599529-105599551 CCCTCCATGAACACAAAGGAAGG + Intergenic
936523427 2:113226895-113226917 CCCTCCATGATGAAAAGGGAGGG - Intronic
937933848 2:127226711-127226733 TCCTCCCTGTAGACATTGGCAGG + Intergenic
946585587 2:221183650-221183672 CAATCCCTGTAGAAAATGGAGGG + Intergenic
1169573558 20:6932372-6932394 CACTCCATGTAGAAACTGAAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170796432 20:19551514-19551536 CTCACCATGAAGACAATGGAAGG - Intronic
1177201246 21:17958790-17958812 CCCTCCATACAGAGAATGAACGG - Intronic
1179157527 21:38863163-38863185 CCCTCCATGTAGACAGAGGGGGG - Intergenic
1182479198 22:30595754-30595776 CCCTCCATTCAGACCACGGAGGG + Intronic
963564209 3:146907330-146907352 CCCACCATGCAGATAATGAATGG - Intergenic
972908294 4:43779154-43779176 TCCTCCATGTAGACAAGGGTTGG - Intergenic
983067844 4:163232203-163232225 CCCTGCAAGTTAACAATGGATGG - Intergenic
984656301 4:182322359-182322381 CTCTCCATGTTGCCAATGAAGGG - Intronic
985946065 5:3185065-3185087 CCCTCCTTTTAGATAATGGTTGG + Intergenic
987298085 5:16572077-16572099 CTCTCCATGGAGTCAATGCAAGG + Exonic
990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG + Intergenic
992178607 5:74175010-74175032 ACCTCCTTTTACACAATGGATGG + Intergenic
993746263 5:91601122-91601144 TCCTCCATGTGGCAAATGGACGG - Intergenic
994718645 5:103354080-103354102 CCTTCCATTTATACAATGGTGGG + Intergenic
1000614074 5:163408635-163408657 TCCTCCATGTAGCCACTAGATGG - Intergenic
1000967740 5:167679786-167679808 CCCTACATGTAAAAAAAGGAAGG + Intronic
1001169400 5:169404468-169404490 CCTTCCATGAATACAAGGGAAGG + Intergenic
1004142874 6:13036959-13036981 CCCTCCATGTTTGCTATGGAGGG - Intronic
1004583778 6:16979669-16979691 ACCTCAATGTAGTCAATAGATGG + Intergenic
1007960213 6:45951999-45952021 CCCTCATTTTAGACAATGAAAGG + Intronic
1011598591 6:89039534-89039556 CCCTCCACCAAGACAATGAAAGG + Intergenic
1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG + Intergenic
1015382492 6:132585772-132585794 CCCTCAATGAAGAGAAGGGAAGG - Intergenic
1018991260 6:168675956-168675978 CCCTCTCCATAGACAATGGAGGG - Intergenic
1022163558 7:27735944-27735966 TCATCCAAGTAGACAATGAATGG + Intergenic
1024967137 7:55033752-55033774 CCCGCCATGGAGGCAAGGGATGG - Intronic
1027611839 7:80370734-80370756 CCCTTCATATACACAATGGTGGG - Intronic
1033742371 7:144284814-144284836 TCCTCCATGGAGACAAAGGATGG + Intergenic
1033751531 7:144364800-144364822 TCCTCCATGGAGACAAAGGATGG - Exonic
1036609039 8:10334061-10334083 CCCTGCTTGCAGCCAATGGACGG - Intronic
1041413633 8:57583375-57583397 CCCTGAATGTAGAAAATGGAAGG - Intergenic
1044095835 8:88063210-88063232 CCATCCATCTATTCAATGGATGG + Intronic
1044415808 8:91938065-91938087 CCCTCCATTTAGACCAAGAATGG - Intergenic
1044938721 8:97318825-97318847 CTCACCAAATAGACAATGGAAGG + Intergenic
1047408838 8:124607644-124607666 GCCTCCATCTATTCAATGGAAGG + Intronic
1048007075 8:130428062-130428084 GTCACCATGTAGACAATGGTGGG - Intronic
1050438468 9:5634338-5634360 CCCTCCCTGTACACTATTGACGG - Intronic
1054713888 9:68538299-68538321 CACTCCCTGTAGGCACTGGAAGG - Intronic
1055363387 9:75519235-75519257 GACTCCATGCAGACATTGGAAGG + Intergenic
1059599844 9:115765091-115765113 CCCTCCATCTAGGAAATGAAGGG - Intergenic
1062248139 9:135580542-135580564 CGCTCCCTGCAGACAAGGGAGGG + Intergenic
1062251368 9:135597005-135597027 CCCTCCATCTGGACTCTGGAGGG + Intergenic
1187832190 X:23393568-23393590 CGATCCATGTATACAAAGGACGG - Exonic
1189135323 X:38543177-38543199 CCCTCCATGTAGACAATGGATGG + Intronic
1197483286 X:127014030-127014052 CCTTCCATGTAGACAAAGCATGG - Intergenic