ID: 1189135643

View in Genome Browser
Species Human (GRCh38)
Location X:38546759-38546781
Sequence CTGCCAGCATACCTTGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189135638_1189135643 -8 Left 1189135638 X:38546744-38546766 CCACCACCACCACCACTGCCAGC 0: 3
1: 18
2: 298
3: 3398
4: 8302
Right 1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG 0: 1
1: 0
2: 2
3: 20
4: 172
1189135635_1189135643 1 Left 1189135635 X:38546735-38546757 CCACCACCACCACCACCACCACC 0: 1863
1: 3563
2: 7475
3: 11582
4: 18916
Right 1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG 0: 1
1: 0
2: 2
3: 20
4: 172
1189135636_1189135643 -2 Left 1189135636 X:38546738-38546760 CCACCACCACCACCACCACCACT 0: 89
1: 2312
2: 4569
3: 9149
4: 15550
Right 1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG 0: 1
1: 0
2: 2
3: 20
4: 172
1189135637_1189135643 -5 Left 1189135637 X:38546741-38546763 CCACCACCACCACCACCACTGCC 0: 13
1: 152
2: 2597
3: 5942
4: 12642
Right 1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG 0: 1
1: 0
2: 2
3: 20
4: 172
1189135634_1189135643 21 Left 1189135634 X:38546715-38546737 CCAGTACACAGACACACACACCA 0: 1
1: 1
2: 20
3: 342
4: 2890
Right 1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG 0: 1
1: 0
2: 2
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189135643 Original CRISPR CTGCCAGCATACCTTGTCCT AGG Intronic
901002851 1:6157262-6157284 CTGCCTGCATACCTGGACATGGG + Intronic
901568263 1:10137210-10137232 GTGCCATGATACCGTGTCCTGGG + Intronic
902521327 1:17018662-17018684 GTGCCAGGAGTCCTTGTCCTTGG - Intergenic
902523027 1:17032644-17032666 CTCCCAGCATGACATGTCCTTGG - Intronic
905693463 1:39958866-39958888 CTTCCAGCATATCTGCTCCTTGG + Intronic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
910733772 1:90428781-90428803 CTGCCAGCATTCCTTGGCTTGGG - Intergenic
914756952 1:150568237-150568259 ATCCCAGCACACCTTGTCCCAGG + Intergenic
915334255 1:155131497-155131519 CTGCCAGCGGACTTGGTCCTTGG - Exonic
919616724 1:199817086-199817108 ATGGCAGCAAAGCTTGTCCTGGG + Intergenic
919742598 1:200989930-200989952 CTCCCAGCTTACCTTGTCAATGG + Exonic
919812000 1:201414614-201414636 CTCCCAGCATTCCTTGGCCTTGG + Exonic
920007890 1:202846616-202846638 CTGCCAACACATCTTGACCTTGG + Intergenic
922906407 1:229176713-229176735 CTGCAGGCATTCCTTGGCCTGGG - Intergenic
924212242 1:241782482-241782504 CTGACACCTTACTTTGTCCTGGG - Intronic
1062952662 10:1516279-1516301 CTGCCGGCCTCCATTGTCCTGGG - Intronic
1067024600 10:42833149-42833171 CTGCCTACATACATTGTCTTTGG - Exonic
1073648302 10:105330405-105330427 CCGGCAGAATTCCTTGTCCTTGG + Intergenic
1074219368 10:111421104-111421126 CTGCCACCACACCATGACCTTGG + Intergenic
1074995916 10:118756923-118756945 CTGTCAGCATTCCTTGACTTGGG - Intergenic
1076156896 10:128211284-128211306 CTGGCAGCATCCCCTGCCCTGGG - Intergenic
1076613015 10:131738056-131738078 CGGCCAGCCTACCTGGTCCTCGG - Intergenic
1077031433 11:469688-469710 CTGCAAGCATAGCTGGTTCTAGG - Intronic
1077119353 11:899678-899700 CTGCCAGTATGCCTGGGCCTCGG - Intronic
1079448976 11:20582847-20582869 CTGCCTGCATTTCTTGGCCTGGG - Intergenic
1081677907 11:44981666-44981688 CTGCCTGCATTCCTTGGCTTGGG + Intergenic
1083292554 11:61697988-61698010 CTGCCAGAAGACCTGGTACTGGG - Intronic
1083331090 11:61898771-61898793 CACCCAGCATGCCTTGGCCTTGG + Intronic
1084164161 11:67367249-67367271 CTGCCCACATGCCTAGTCCTGGG + Intronic
1084647788 11:70469871-70469893 CTGCCAAGATACCTTTTCCAGGG - Intronic
1086562974 11:88189279-88189301 CTCCCAGCATACAGTGTCCCAGG - Intergenic
1086562996 11:88189574-88189596 CTCCCAGCATACAGTGTCCCAGG - Intergenic
1087065832 11:94027099-94027121 CTGCCAGCATTCCTTGGCTGTGG + Intronic
1088470839 11:110186578-110186600 CTGCCTGCCTACCTTCTCCTTGG - Intronic
1089683096 11:120130371-120130393 TTTCCATCAGACCTTGTCCTCGG - Intronic
1091636884 12:2203757-2203779 CTGCCTTCATACTTGGTCCTGGG + Intronic
1093063657 12:14633168-14633190 GTGCCAGCATAAGCTGTCCTTGG - Intronic
1094112321 12:26874802-26874824 GTGTCAGCAAAACTTGTCCTTGG - Intergenic
1094551062 12:31451973-31451995 CAGCCAGGATTCCATGTCCTGGG + Exonic
1097848838 12:64391572-64391594 CTTCCTGCATAGATTGTCCTGGG - Intergenic
1098905303 12:76155635-76155657 GAGCCACCATGCCTTGTCCTGGG - Intergenic
1100037651 12:90272700-90272722 TTTCCAGCATACCTGGACCTGGG + Intergenic
1101279888 12:103242016-103242038 CTGTCACTTTACCTTGTCCTTGG - Intronic
1110607925 13:77454724-77454746 CTCCTGCCATACCTTGTCCTAGG - Intergenic
1112829932 13:103437062-103437084 TTCCCAGCATCCCTTGTACTGGG + Intergenic
1112830307 13:103441353-103441375 CTGCAAGCATACCTTGACGATGG - Intergenic
1113037980 13:106071980-106072002 CTGCCAGCAAACATTGTCCCAGG + Intergenic
1116631904 14:47346746-47346768 CTGCCAGCATTCCAAGTACTGGG + Intronic
1117834780 14:59792134-59792156 CTGCCAGCATACTTTTTGCTGGG + Intronic
1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG + Intergenic
1118167963 14:63356680-63356702 CTGCCAGCAGTCCTTGGCTTGGG + Intergenic
1118304503 14:64644494-64644516 CAGCCAGCATTCATTCTCCTAGG + Intergenic
1120953200 14:90061107-90061129 CGGCCAGGAGACCTTGACCTTGG - Intergenic
1122197097 14:100096431-100096453 CTGGCAGCCTACCTTGTGCCAGG + Intronic
1124156826 15:27233349-27233371 CTAACAGAATACCTTGTCCCTGG + Intronic
1124336926 15:28864342-28864364 ATCCCACCATACCTTGTCATGGG + Intergenic
1124702170 15:31925517-31925539 CTGCCATCCTACCCTGTCCCAGG + Intergenic
1126066442 15:44829690-44829712 GTTCCAGCATTCCTTGACCTTGG - Intergenic
1126093440 15:45071179-45071201 GTTCCAGCATTCCTTGACCTGGG + Intronic
1126110129 15:45170070-45170092 CTGCCAGCCTGCCTTAGCCTGGG - Intronic
1126661566 15:51038403-51038425 GTGCCAGCATACGCTGCCCTGGG - Intergenic
1126757117 15:51935685-51935707 CTACCAGCATCCCTTCTCATTGG + Intronic
1127524550 15:59779430-59779452 CTGCCAGGGTAGCTTCTCCTTGG - Intergenic
1129272798 15:74428291-74428313 CTGCCATCATACTCTGTCCCAGG - Intronic
1129324113 15:74790520-74790542 CTCCCAGCAGCCCTTGTGCTGGG - Intronic
1129877869 15:78988589-78988611 CCGCCAGCACACCATATCCTGGG - Intronic
1130182328 15:81643185-81643207 CTGCCTGCAGACCTTGCACTTGG + Intergenic
1130311583 15:82760663-82760685 CTGCTAGGAGACCTTATCCTAGG + Intronic
1130924009 15:88371694-88371716 CTGCCGGCATCTCTTATCCTTGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131658406 15:94485704-94485726 GTGCCAGCATACACTGTCCTAGG + Intergenic
1132814911 16:1821064-1821086 CTGCCACCATGCCTCCTCCTGGG - Intronic
1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG + Intronic
1136859073 16:33685248-33685270 CTGCCTACATACATTGTCTTTGG + Intergenic
1138064659 16:53927963-53927985 CTGCCAATCTACCTTGTGCTAGG - Intronic
1138278569 16:55755087-55755109 CTGCCAGCAATCCTTGTCACAGG - Intergenic
1138289985 16:55838534-55838556 CTGCCAGCAATCCTTGTCACAGG + Intergenic
1138615447 16:58161892-58161914 CCGCCTGCCTGCCTTGTCCTGGG - Intronic
1141700383 16:85639533-85639555 CCCCCATCATCCCTTGTCCTTGG + Intronic
1141788379 16:86216801-86216823 CTGCAACCACACCCTGTCCTGGG + Intergenic
1142137325 16:88457483-88457505 CTCTCAGCTTACCTGGTCCTTGG + Intronic
1203120585 16_KI270728v1_random:1533432-1533454 CTGCCTACATACATTGTCTTTGG + Intergenic
1143171078 17:4930779-4930801 CTGCCAGCATTCCTAGTCCAAGG - Intergenic
1143368176 17:6422011-6422033 CTGCCAGCAAACTAGGTCCTTGG - Intronic
1143633043 17:8149648-8149670 CTGCCAGGATACCTTCTCAGTGG - Exonic
1145789798 17:27619224-27619246 ATGGCAGCATTCCTTATCCTAGG + Intronic
1146297388 17:31660473-31660495 ATGCCAGCAGACCTGCTCCTAGG + Intergenic
1146424815 17:32727176-32727198 CTGCTAGCAAACCGTGTTCTTGG - Intronic
1147790601 17:43012267-43012289 CTCCCACCTTACCTTGTCTTTGG - Exonic
1152253522 17:79224221-79224243 CTGCCTGGATTCCCTGTCCTTGG - Intronic
1152258112 17:79252072-79252094 CTGGAAGCACACTTTGTCCTGGG + Intronic
1155584169 18:27345697-27345719 CTGCCAGCTTGCCTTACCCTTGG + Intergenic
1157830430 18:50852226-50852248 CTGCAAGCTTGCATTGTCCTGGG - Intergenic
1161079919 19:2305601-2305623 ATGTCAGCATCCCTTGCCCTGGG - Intronic
1162391677 19:10393721-10393743 CTCCCAGCCTGCCTTGTCCTTGG + Intronic
1162983400 19:14253901-14253923 TTGCCAGCCTCCCTTGGCCTTGG + Intergenic
1163685633 19:18710266-18710288 GAGCCAGCACAGCTTGTCCTGGG + Intronic
926892261 2:17648930-17648952 CTGCCACCAGCCCTCGTCCTGGG - Intronic
927793171 2:26026774-26026796 CTGCCTGCATATCTTGACTTAGG - Intergenic
927804621 2:26135746-26135768 CTGCCACCATTTCTTCTCCTTGG + Exonic
928699185 2:33881410-33881432 CTGCCAGCAACCATTGACCTAGG - Intergenic
931856226 2:66304247-66304269 CTGCCAGCGTTCCTTGCCTTGGG + Intergenic
934653546 2:96105563-96105585 GAGCCAGCATACCTTGACTTAGG - Intergenic
935520398 2:104096992-104097014 CTCCCTGCAGTCCTTGTCCTAGG - Intergenic
940481491 2:154238015-154238037 GTGCCAACATTCCTGGTCCTTGG - Intronic
942025909 2:171910855-171910877 CTGCAAACCTACATTGTCCTTGG - Intronic
942802363 2:179890308-179890330 TTGCCAGCAGCCCGTGTCCTAGG + Intergenic
948195284 2:236091080-236091102 CTGCCTGCATGCCCTGTCCTTGG + Intronic
948657511 2:239485824-239485846 CTGCCAGGATCCCATGTCCCTGG - Intergenic
1170995366 20:21350628-21350650 CTTCCACCATACATTTTCCTAGG + Intronic
1174301252 20:49584134-49584156 CTGCCAGCCTTCCTTCTCCCTGG - Intergenic
1175676622 20:60951686-60951708 CCTCCAACACACCTTGTCCTTGG + Intergenic
1175901022 20:62359971-62359993 CTGCCAGCAGCCTTTGTTCTGGG - Intronic
1176257529 20:64160002-64160024 CTCCCACCATACCTTGTGCCTGG + Intronic
1178267041 21:31153054-31153076 TTTCCAGCATACCTCATCCTGGG + Exonic
1179114571 21:38478211-38478233 TTGCCAGGATATCTTGTCCCAGG - Intronic
1179215392 21:39362774-39362796 CTCCCTTCATACCTTCTCCTTGG - Intergenic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1180065609 21:45410730-45410752 CTGCCAGCACAGCTGCTCCTGGG + Intronic
1182355968 22:29722333-29722355 CTGCCAGCACGCCATGTCGTTGG - Intronic
1183430294 22:37761807-37761829 CTGGGGGCTTACCTTGTCCTGGG + Intronic
1184552375 22:45211155-45211177 CTGCCAGCAAACCATGGCCCCGG + Intronic
1185203837 22:49525442-49525464 CTGACTGCATACCATGTGCTGGG + Intronic
949776787 3:7642215-7642237 CTACCAACATACCTTGTCCTGGG + Intronic
950554631 3:13687921-13687943 CTGCCTGCATGCCCTGTCCTGGG - Intergenic
950873995 3:16253728-16253750 CTGCTAGCTTGCCTTGTTCTGGG + Intergenic
950926507 3:16746613-16746635 CTGCAGGCATTCCTTGGCCTGGG - Intergenic
951189381 3:19750248-19750270 TTGAGAGCATACCGTGTCCTAGG - Intergenic
952259004 3:31721154-31721176 CTGCCTGCATTCCTTGGCTTGGG - Intronic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
952344417 3:32470581-32470603 CTGCCATCCTACCTGGTACTTGG + Intronic
953569239 3:44058175-44058197 CTGCCAGCATGCCCTCTCCAGGG + Intergenic
954563692 3:51580297-51580319 CTCCCTCCATACCTTGTCCTTGG - Intronic
955351728 3:58198376-58198398 CTGCTGGCACACCTTGTTCTGGG + Intronic
956640670 3:71412616-71412638 ATGCAACCAAACCTTGTCCTTGG + Intronic
959161034 3:102724742-102724764 CTTCCAGCAAACCTTTGCCTGGG - Intergenic
959686609 3:109154139-109154161 CTGCCATCTTTCCTTGGCCTAGG + Intergenic
962060902 3:131926210-131926232 CTGCCAGCATTCCATCACCTTGG - Intronic
965671942 3:171156676-171156698 TTGGCTGCATGCCTTGTCCTGGG - Intronic
968709506 4:2102636-2102658 GTGCCAGCATATGTTGTCCCAGG + Intronic
969609432 4:8218821-8218843 CTGCCAGCAGCCCTTCTCCTTGG + Intronic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
970757503 4:19443771-19443793 GTGCCAGCATTTGTTGTCCTAGG + Intergenic
971479577 4:27102299-27102321 CTTCCAGCATACCTCCTCCCCGG + Intergenic
984624907 4:181996182-181996204 CTTCAAGCTTACCTTCTCCTGGG + Intergenic
985285471 4:188332389-188332411 GTGCCAGCATACTTGGTTCTTGG - Intergenic
985395258 4:189537061-189537083 ATGCCAGCATTCCTTCCCCTCGG + Intergenic
993294033 5:86110869-86110891 CTGTCAGCATTCCTTGACTTGGG + Intergenic
997449645 5:133971506-133971528 ATGCCAGCATTCCTTGCCATGGG - Intergenic
999353676 5:150903883-150903905 CTGTCTGCATGACTTGTCCTGGG - Exonic
999670571 5:153955876-153955898 CTGCCAGCATTCCTTGGCTTAGG + Intergenic
1001053104 5:168428302-168428324 CAGACAGCATAACTTTTCCTGGG + Intronic
1001263562 5:170254920-170254942 CTGCCAGGACACCTGGTCCTCGG - Intronic
1003143750 6:3492823-3492845 CAGCCAGCATACCTTTACCAAGG + Intergenic
1006655945 6:35593091-35593113 CTGCCAGAATATCTTGGCGTGGG - Intronic
1006795787 6:36731605-36731627 CTGCTGGCATACCTTGTCCATGG + Intronic
1007177191 6:39905082-39905104 TTGCCAGCACACCTTGGCATAGG + Exonic
1010661972 6:78582114-78582136 CTGCCAGTAGACCTTGTCTGAGG + Intergenic
1013158684 6:107520583-107520605 CTTTCAGGATACCTTGTCCCAGG + Intronic
1018462933 6:164016512-164016534 CTGGCAGCAAACCGTGTCTTTGG - Intergenic
1023047673 7:36225017-36225039 CTGCCTGCATTCCTTGTTTTTGG - Intronic
1025004269 7:55342865-55342887 CTGCCCTCAGCCCTTGTCCTTGG - Intergenic
1027162867 7:75814999-75815021 CCACCCCCATACCTTGTCCTGGG - Intronic
1029653918 7:101912035-101912057 CTGCCAGCTTCCCATGACCTGGG + Intronic
1031177405 7:118370658-118370680 CTGCCTGCCTATTTTGTCCTTGG + Intergenic
1031206443 7:118764196-118764218 CTGCCAGCCTCCCTTGTTGTTGG + Intergenic
1031683832 7:124708679-124708701 ATGCCAGCATACATTGCCCTGGG - Intergenic
1031869912 7:127080243-127080265 CTGCCAGCATTCCTTGGCTATGG - Intronic
1032811308 7:135420998-135421020 CTGCCAGCATCCCTGGACCTAGG + Intronic
1033071638 7:138208667-138208689 CTGCACCAATACCTTGTCCTAGG + Intergenic
1034319205 7:150164033-150164055 ATGCCAGCATACCCTAGCCTGGG - Intergenic
1034773554 7:153803175-153803197 ATGCCAGCATACCCTAGCCTGGG + Intergenic
1036479000 8:9121028-9121050 CAGCCAGCATTGTTTGTCCTGGG - Intergenic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1037463580 8:19137474-19137496 CTGCCATCTTACTGTGTCCTAGG - Intergenic
1037950431 8:23015829-23015851 CTGCCAGTAATCCTTGACCTTGG + Intronic
1039501262 8:38019353-38019375 ATGCCAACAGACTTTGTCCTAGG - Intergenic
1044177723 8:89150539-89150561 CTGCTAACATACCAAGTCCTGGG - Intergenic
1048222124 8:132551735-132551757 CTCACAGCAGACCTTGCCCTTGG - Intergenic
1052211976 9:25915398-25915420 CTGACAGCATACATTGTTCTGGG - Intergenic
1053185128 9:36009538-36009560 CTGCCAACATAATTTGTTCTTGG + Intergenic
1056038828 9:82638056-82638078 GTGCCAGCATACATTGCCTTGGG + Intergenic
1056543707 9:87595675-87595697 CTTCCAGGAGACCTTGTCCTTGG + Intronic
1057468213 9:95335461-95335483 CTGCCTGCATTCCTTGGCCCTGG + Intergenic
1057837901 9:98461135-98461157 CTGCCAGAAGAACTTCTCCTTGG - Intronic
1058748808 9:108018456-108018478 CTGTCAGCATCCCTTGACGTGGG - Intergenic
1060386599 9:123235182-123235204 TTGCCAGCATTCCTTGTCTGTGG + Intronic
1061328518 9:129878484-129878506 CTGCCAGCATCCCATCTCCCAGG - Intronic
1186807021 X:13150130-13150152 TTGACAGCATGCCTTGTACTAGG - Intergenic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1189734384 X:44054721-44054743 CTCCCAGCATTCCATGTACTAGG + Intergenic
1192269360 X:69564349-69564371 CTGCCGGCATTCCTTGGCTTGGG + Intergenic
1195622755 X:106973783-106973805 CTGCCAGCATTTCTTGCCCATGG - Intronic
1198319816 X:135509609-135509631 CTGCCAACTATCCTTGTCCTTGG - Intergenic
1200071352 X:153531004-153531026 CTGCATGCAGGCCTTGTCCTTGG + Intronic