ID: 1189137555

View in Genome Browser
Species Human (GRCh38)
Location X:38564391-38564413
Sequence TGGGGGACATTTGAGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189137549_1189137555 20 Left 1189137549 X:38564348-38564370 CCATTGAATGATTATAGCACATT 0: 1
1: 1
2: 12
3: 229
4: 1656
Right 1189137555 X:38564391-38564413 TGGGGGACATTTGAGTTGATTGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189137555 Original CRISPR TGGGGGACATTTGAGTTGAT TGG Intronic
901333862 1:8431778-8431800 CGGGGGAGATTTGAGGTGCTAGG - Intronic
901700897 1:11044366-11044388 TGGGGGGCATTTGAGTTGTGAGG + Intronic
904447360 1:30585940-30585962 TGGTGGACATTTGAGTGCAGAGG - Intergenic
904890246 1:33774256-33774278 AGGGGGACATGTGAGGTGAGAGG - Intronic
905537379 1:38733319-38733341 TGGCCCTCATTTGAGTTGATTGG - Intergenic
908029008 1:59980377-59980399 TGGGGGCCATTTGAGGAGATAGG - Intergenic
909519273 1:76548223-76548245 GAGGGGACATTTAAGTTGAGAGG - Intronic
921616700 1:217276819-217276841 TGGGAGGCAATTGAGCTGATGGG + Intergenic
921783857 1:219202531-219202553 TAGGGTACATTTAAGTTGTTAGG + Intronic
921787571 1:219249438-219249460 TGATGTACATTTGAGTTGTTAGG + Intergenic
921876890 1:220207283-220207305 TGGTGGAAATATAAGTTGATAGG - Intronic
922072861 1:222213512-222213534 TGGGGTAGATATGAGTTGACTGG - Intergenic
922929852 1:229380723-229380745 TGGGGGACCTGTGATTAGATCGG + Intergenic
1063521709 10:6747452-6747474 AGGGGGACCATTGAGTTGGTCGG - Intergenic
1064009004 10:11720348-11720370 TGTGGGACATTTGAGGTCAGTGG + Intergenic
1065706322 10:28474481-28474503 TGGGGGAAATTTGAGGAGAGAGG + Intergenic
1066453587 10:35553176-35553198 TGGAGGACATGTGAGTTGGGGGG + Exonic
1068178256 10:53489658-53489680 TGGGAGATATTTGAGTTATTAGG - Intergenic
1069026207 10:63545247-63545269 TGGTAAACATTTGAGATGATGGG - Intronic
1069870629 10:71530640-71530662 TTGGGGACATGTGAGATGAGAGG - Intronic
1073418677 10:103406028-103406050 TAGTGGACATTGGTGTTGATGGG + Exonic
1074895500 10:117773742-117773764 TGGCGGGCATTTGGGCTGATTGG - Intergenic
1074942091 10:118245991-118246013 TGGGAGACAATTGAGGGGATGGG - Intergenic
1076478757 10:130770140-130770162 TTGGGGACATTTGAGTTCCTAGG + Intergenic
1079836403 11:25340183-25340205 TGTTGGACATTTGGGTTGGTGGG - Intergenic
1080187965 11:29513416-29513438 TGAAGGTCATTTGAGATGATTGG + Intergenic
1081462587 11:43285699-43285721 TGGGCAACATGTGAATTGATAGG + Intergenic
1082601194 11:55157688-55157710 TGGGAGACATTTGAGGTCAATGG - Intergenic
1084727882 11:70953715-70953737 AGGTGGACATTTGAGTTGGTGGG - Intronic
1087452409 11:98342016-98342038 TGGAGAACATTAGACTTGATCGG + Intergenic
1087655840 11:100921994-100922016 TGGGGGACAGGTGAGCTGAGAGG + Intronic
1089231273 11:116978954-116978976 TGCTAGACATTTGAGTTGTTTGG + Intronic
1093381153 12:18494891-18494913 TGGGTTAGATTTGTGTTGATAGG - Intronic
1093381163 12:18495048-18495070 TGGGTTAGATTTGTGTTGATAGG + Intronic
1095841489 12:46698561-46698583 TGGGTGAGACTTTAGTTGATTGG - Intergenic
1099935447 12:89119460-89119482 TGGAGGACATTTGAAATCATAGG - Intergenic
1102822305 12:115918114-115918136 TGGTGGACATTTGAGATAAGTGG + Intergenic
1104149309 12:126067096-126067118 TGGGGGACATCTGAGTTTCCTGG + Intergenic
1106467408 13:30025147-30025169 TTGTGGACATTGGAGTTGAGTGG - Intergenic
1107232614 13:38128531-38128553 TAGTGGACATCTGGGTTGATTGG + Intergenic
1109212344 13:59548599-59548621 AGCGGGATATTTGAGTTGTTTGG - Intergenic
1110774650 13:79394116-79394138 TGGAGGTCATTTGAGCTGGTAGG - Intronic
1112619430 13:101039526-101039548 TGGGGGATTTTTAAGTTGAATGG + Intergenic
1119605536 14:76013068-76013090 AGGAGGACTCTTGAGTTGATGGG + Intronic
1121363069 14:93279869-93279891 AGGGGCTTATTTGAGTTGATAGG + Intronic
1124185317 15:27520419-27520441 ATGGGGACTTTTGAGTTGACAGG - Intronic
1124442309 15:29696123-29696145 TGGTGGACACTTAAGTTGCTGGG + Intergenic
1127444659 15:59048645-59048667 TGGGTGACATTTGTATTGACAGG + Intronic
1128054020 15:64686468-64686490 TGGGGGACACTTGATTTCAACGG + Intergenic
1128211810 15:65908625-65908647 TGGGAGACATTGGACTTTATTGG + Intronic
1128927426 15:71670897-71670919 TGATGGACATTTGGGTTGGTTGG + Intronic
1129601060 15:76998484-76998506 TGGGTGAAATTAGAGTTCATAGG - Intronic
1131761442 15:95627145-95627167 TGGGGAACAGTTGACTTAATTGG + Intergenic
1140202429 16:72905361-72905383 TGGGGGACATTGTGGCTGATTGG - Intronic
1140348199 16:74235281-74235303 TGGTGGACATTAGAATTGACAGG - Intergenic
1142956272 17:3524967-3524989 TGGGGGACTTTTGCTATGATTGG - Intronic
1143833433 17:9670726-9670748 GGAGTGACATTTGAGCTGATTGG + Intronic
1144014812 17:11183815-11183837 TGATGGACATTTGAGTTGGGGGG + Intergenic
1145246388 17:21272634-21272656 TGGAGGACCTTTGTGATGATTGG - Intergenic
1151122446 17:71808162-71808184 CCGTGGACATTTGAGTTGACAGG + Intergenic
1152024481 17:77799783-77799805 TGATGGACATTTGGGTTGTTTGG - Intergenic
1152699114 17:81810528-81810550 TGGGGCACATTTGAGATGGGGGG + Intronic
1156616904 18:38797848-38797870 TGAGGGAAATTTGTGTAGATAGG - Intergenic
1159634608 18:70789713-70789735 CTGTGGACTTTTGAGTTGATTGG - Intergenic
1159851107 18:73528179-73528201 TGATGGGCATTTGAGTTGGTAGG + Intergenic
1160171909 18:76562343-76562365 TGGGGGACAATGGAGAGGATGGG - Intergenic
1167192176 19:47998824-47998846 TGGGGGACATTTCACTGGAAAGG + Intronic
1168472161 19:56648519-56648541 GGGTGGACAGTTGAGTGGATAGG - Intronic
925322240 2:2981921-2981943 TGATGGACATTTGGGTTAATGGG + Intergenic
929632565 2:43479952-43479974 TGTGGGAGATTTGAGATTATTGG + Intronic
931312711 2:61097207-61097229 TGGAAAACATTTGAGGTGATTGG + Intronic
932463128 2:71896127-71896149 TGGGGGAGAGGAGAGTTGATTGG - Intergenic
933161318 2:79027289-79027311 TGGGGGACATTTGGGAGAATAGG + Intronic
935711598 2:105903597-105903619 AGGGGGATATTAGAGTTGTTAGG + Intergenic
937128531 2:119489763-119489785 TGGTTGACAGTTGAGCTGATTGG + Intronic
938737015 2:134195057-134195079 TGGGGGATATTTGAGATCAGAGG - Intronic
940018320 2:149130203-149130225 TGGGGGACAGATCAGTAGATTGG - Intronic
940049404 2:149446459-149446481 TGGGTTACATTTGAATTGAAAGG - Intronic
940378394 2:152985122-152985144 TGGGGGATATTTGACTAGTTTGG + Intergenic
942374481 2:175322847-175322869 TGGGGGAGATTTTAGTAGCTTGG + Intergenic
945204347 2:207315865-207315887 CTGGGGAAATTTGAGTTTATTGG + Intergenic
946963273 2:225008017-225008039 TGGGTGACATTTGAGCATATTGG - Intronic
947106359 2:226672076-226672098 TGGGGGATATTTGTGTTCAGGGG - Intergenic
947345062 2:229182133-229182155 TTGGGCACATTTGTTTTGATAGG - Intronic
1171411284 20:24950293-24950315 TGGGGGTCATATGACTTGAGCGG - Intronic
1172059797 20:32179513-32179535 TCTGGGACATTTGAGTTACTTGG + Intergenic
1172946622 20:38694249-38694271 TGGAGGTCATTGGAGTTGACAGG - Intergenic
1173416307 20:42859194-42859216 TGAGGGTCATTTGGGATGATTGG - Intronic
1176672050 21:9744442-9744464 TGGGGGCCACCTGAGTTGTTGGG + Intergenic
1178946436 21:36952096-36952118 AGAAGGACATTTGAATTGATGGG - Intronic
1179589636 21:42397942-42397964 TGGGGCAAATTTGGGTTGACAGG + Intergenic
1182565155 22:31193010-31193032 TGGGGGACTGTTGATATGATAGG - Intronic
1183894871 22:40960238-40960260 TGTGGGAGCTTTGAGTTGAGGGG + Intronic
954374903 3:50188967-50188989 TGGGGGGCAGTTGGGTAGATGGG + Exonic
954797074 3:53166989-53167011 TGGGGGACACAGGAGTTGATAGG - Intronic
955224256 3:57048286-57048308 TGGTGGACATGTGACTTGACTGG - Intronic
956393805 3:68803343-68803365 AGAGGGAGATTTGATTTGATTGG + Intronic
956871271 3:73420638-73420660 TGGGGGACAGTTAAAATGATGGG - Intronic
958558498 3:95710475-95710497 TAATGGACATTAGAGTTGATTGG + Intergenic
960034276 3:113086853-113086875 TGGGGGACATTTGAGGTGGGAGG + Intergenic
964508215 3:157422249-157422271 TGGGGGACATGAAAGTTGAAAGG + Intronic
970171069 4:13291015-13291037 TCATGGACATTTGAGTTGACAGG - Intergenic
970879816 4:20915927-20915949 TGGGGCACATTGGAGTTGAAAGG + Intronic
972987229 4:44779444-44779466 TGTGGCCCATTTGAGGTGATGGG + Intergenic
973212148 4:47627941-47627963 TGGGGGCCTTTTGAGTTGAAAGG - Intronic
973563871 4:52164131-52164153 TGGGGGACACTTGAGGTCTTAGG - Intergenic
975415508 4:74099579-74099601 TGGAAGACATTTCAGTTGTTGGG + Intergenic
976972817 4:91128429-91128451 TGGGGGTCGTTTTAGTTGAGAGG - Intronic
977651446 4:99474338-99474360 CTGGGGACATTGGAGATGATGGG + Intergenic
979203780 4:118010325-118010347 TGGAGTGCCTTTGAGTTGATTGG + Intergenic
979470424 4:121089992-121090014 TGGGGGTGATTTGAGTGGCTGGG + Intergenic
985402686 4:189607406-189607428 TGGGGGCCACCTGAGTTGTTGGG - Intergenic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
989121819 5:38011978-38012000 AGCAGGACATTTGAATTGATTGG + Intergenic
991410941 5:66345098-66345120 TGTGAGACATTTGACTTGACCGG + Intergenic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
993189872 5:84668546-84668568 TGGGGGGCATTTGTGCGGATTGG + Intergenic
995834627 5:116387631-116387653 TGAGGGTCATGTTAGTTGATGGG - Intronic
996526315 5:124483941-124483963 TGGAGAACATTTGAGTGGTTTGG - Intergenic
998562042 5:143180867-143180889 TGGCAGACATTTGGGTAGATGGG - Intronic
1000256900 5:159547993-159548015 TTGGCAACATTTGATTTGATCGG + Intergenic
1000962561 5:167617641-167617663 TAGGGGATATTAGAGTTGAGTGG - Intronic
1004870280 6:19897243-19897265 TGATGGACATTTGGGTTGAAAGG - Intergenic
1005439096 6:25846316-25846338 TTATGGACATTTGAGTTGTTTGG - Intronic
1006191082 6:32209910-32209932 TGGGGTACATGTGAGTTTTTTGG - Intronic
1006923385 6:37640689-37640711 GGGGGGACATTGGAGCTGATGGG + Intronic
1007822292 6:44569556-44569578 TGGAGGACATTTGAGCAGTTAGG - Intergenic
1010960742 6:82142915-82142937 TGGAGGTCATTAGAGTTCATGGG + Intergenic
1011220440 6:85049255-85049277 TTGGAGACATTTGAGTGGTTGGG - Intergenic
1012386146 6:98685635-98685657 TGGGCAACATTTCTGTTGATAGG - Intergenic
1014530560 6:122554006-122554028 TGGTGGACATTTGCATTTATAGG + Intronic
1014873333 6:126624290-126624312 GGCGAGGCATTTGAGTTGATGGG + Intergenic
1014921211 6:127215790-127215812 TGGGGGACTTTTGATTTAGTGGG - Intergenic
1016618330 6:146078935-146078957 TGGGGGAGAATGGAGTTTATTGG + Intronic
1016743291 6:147551130-147551152 TGGGGCACAGTTCAGTTGTTAGG + Intronic
1020853227 7:13383994-13384016 TGGGGGAAATTAGAGGTTATTGG + Intergenic
1022591346 7:31666726-31666748 AAGGGGACATTTGGGGTGATAGG - Intergenic
1024467709 7:49730226-49730248 TGATGGACAGTTGAGTTGAAGGG + Intergenic
1032002779 7:128276089-128276111 TCGGGGACAGTTCAGTTGCTTGG + Intergenic
1033044815 7:137952423-137952445 AAGGTGACATTTGAGTTGAAAGG - Intronic
1033192945 7:139299164-139299186 TTGGATACATTTGATTTGATGGG + Exonic
1033228632 7:139579989-139580011 TGGGGGACCTTTGAGTCTAATGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034145984 7:148872070-148872092 TGGTGGACATTTGGGTTGCTTGG - Intronic
1034976295 7:155450775-155450797 TGCGGGACAGTTGTGTCGATGGG - Intergenic
1035528139 8:330475-330497 TGGGTGACATTTTGCTTGATGGG - Intergenic
1039550779 8:38441316-38441338 TGGGGGACACTGGTGCTGATTGG - Intronic
1040627603 8:49168293-49168315 CAGGGGACATGTGAGTTGCTGGG + Intergenic
1043137920 8:76550811-76550833 TGGGAGATATTTGAGTTGTAGGG - Intergenic
1046675262 8:117101146-117101168 TGGGGGCCATATGGGTTCATGGG - Intronic
1047196204 8:122723801-122723823 TGGAGGACATTTAAATTGCTTGG + Intergenic
1050066099 9:1760931-1760953 TGATGGACATTTGGGTTGAGAGG - Intergenic
1052149262 9:25093343-25093365 AGGGGGAAATTTGTGTTGACTGG + Intergenic
1052390663 9:27875538-27875560 TGGGAGACACCAGAGTTGATAGG + Intergenic
1055744272 9:79425756-79425778 TTGGGGACATTTGAGCTTCTTGG + Intergenic
1055955161 9:81766369-81766391 TGGGAGACAGTTGAGCTGATGGG + Intergenic
1059657095 9:116367161-116367183 TGGGGGACATTTCAGGAGATGGG + Intronic
1061672248 9:132195262-132195284 TGGGGGATATTTGAGGTTTTGGG + Intronic
1203346988 Un_KI270442v1:41963-41985 TGGAGTACATTTGAGTGGAGTGG + Intergenic
1187832735 X:23399341-23399363 TGGGGGCCAAATGAGTTCATGGG + Exonic
1188923268 X:36006481-36006503 TGGAGGACATTTGAAATGACTGG - Intergenic
1189137555 X:38564391-38564413 TGGGGGACATTTGAGTTGATTGG + Intronic
1197327940 X:125117291-125117313 TGTTGGACATTTGGGTTGGTGGG - Intergenic
1198176708 X:134163689-134163711 GAGGTGACATTTGAGTAGATGGG - Intergenic
1199141723 X:144321384-144321406 TGTTGGACATTTGGGTTGGTTGG - Intergenic
1201121770 Y:10878848-10878870 TGGAGGACAGTTGAGTGGAGTGG - Intergenic