ID: 1189139544

View in Genome Browser
Species Human (GRCh38)
Location X:38587302-38587324
Sequence CAGTTCACATTTATGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189139543_1189139544 15 Left 1189139543 X:38587264-38587286 CCATTCACTGTTATTTTCATGTT 0: 1
1: 1
2: 4
3: 62
4: 686
Right 1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 167
1189139541_1189139544 17 Left 1189139541 X:38587262-38587284 CCCCATTCACTGTTATTTTCATG 0: 1
1: 0
2: 0
3: 36
4: 418
Right 1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 167
1189139542_1189139544 16 Left 1189139542 X:38587263-38587285 CCCATTCACTGTTATTTTCATGT 0: 1
1: 0
2: 2
3: 51
4: 479
Right 1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 167
1189139540_1189139544 30 Left 1189139540 X:38587249-38587271 CCTTACATTTTCTCCCCATTCAC 0: 1
1: 0
2: 1
3: 23
4: 386
Right 1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189139544 Original CRISPR CAGTTCACATTTATGATCTG TGG Intronic
902301447 1:15505488-15505510 CAGATCACAGTTATAAGCTGGGG - Intronic
904143377 1:28370496-28370518 CAGCTCACATCTGTGATCGGTGG + Intronic
905029598 1:34872886-34872908 CAATACATATTTATTATCTGGGG - Intronic
909269990 1:73610838-73610860 GAGTTTACAATTATGCTCTGGGG - Intergenic
910628496 1:89333933-89333955 CAGTTCACATGTATCAAATGTGG - Intergenic
911330353 1:96519479-96519501 CAGTTCACACTTATTACCTGTGG - Intergenic
911552542 1:99301778-99301800 GTCTTCACATTTATCATCTGTGG + Exonic
911869004 1:103067702-103067724 CTGTTCAAATTATTGATCTGGGG + Intronic
912881580 1:113421988-113422010 CAGTTCACACTAATGATAAGAGG - Intronic
913315129 1:117543324-117543346 CAGTTGACATTTCTGATATAGGG + Intergenic
915823434 1:159050573-159050595 CAGATCACATTGCTGGTCTGTGG + Intronic
919003592 1:191866778-191866800 CTGTACACATTTATAATCTATGG - Intergenic
920905375 1:210159581-210159603 CAATGCACATTTATTATCTGTGG + Intronic
923758122 1:236812491-236812513 CACTTCCCATGTATGAGCTGAGG - Intronic
923879704 1:238090231-238090253 CAGCTCCCTTTTATGATCTCTGG + Intergenic
1062820231 10:529158-529180 CAGTTCCCATCTATGAGATGGGG - Intronic
1062993655 10:1845083-1845105 CAGCTCATATGAATGATCTGGGG - Intergenic
1063007765 10:1990270-1990292 TAGTTCAAATTTATTGTCTGTGG - Intergenic
1063229200 10:4047256-4047278 CAGTTTATCTTTATGCTCTGAGG - Intergenic
1063585525 10:7349159-7349181 ATTTTCACATTTATGATCTCTGG - Intronic
1065489026 10:26264256-26264278 CAGTTAGCATATATGATCTGTGG + Intronic
1069251799 10:66276484-66276506 CAGTTCTCATTTATGTTTTAAGG + Intronic
1070319517 10:75344008-75344030 AAGTTCACATTTATCATGTCTGG + Intergenic
1071063974 10:81609030-81609052 CTGTTAACACTTATGATATGTGG + Intergenic
1071913784 10:90267152-90267174 CAGTTTACAGTTATTATATGGGG - Intergenic
1073161206 10:101397528-101397550 CATAGCACAATTATGATCTGAGG - Intronic
1078269051 11:9777642-9777664 CCGTTCACAGTTAAGACCTGAGG + Intergenic
1081920512 11:46771026-46771048 CTGTTATCATTTATGATCTCAGG + Intronic
1083790000 11:64978335-64978357 AGCTACACATTTATGATCTGTGG - Intergenic
1087419667 11:97905799-97905821 CTGTTCACACATATGCTCTGTGG - Intergenic
1087637335 11:100717028-100717050 CACTAAACATTTATCATCTGAGG + Intronic
1087758787 11:102083574-102083596 CAATTCATATTAATGATCAGTGG - Exonic
1088946851 11:114522642-114522664 CATTTTACATGTATGAACTGGGG - Intronic
1094522273 12:31204915-31204937 AAGTTCACTTTTGAGATCTGGGG - Intergenic
1094553480 12:31474402-31474424 AAGTGCCCATTTCTGATCTGGGG + Intronic
1095789298 12:46146750-46146772 CATATCCTATTTATGATCTGTGG - Intergenic
1099659848 12:85543428-85543450 CAGCTCAAATTTATGAAATGTGG - Intergenic
1100029388 12:90167634-90167656 TAGTTCACTTTTCTGAGCTGAGG + Intergenic
1101213182 12:102555092-102555114 CAGTTTACATTTATGCTCCATGG + Intergenic
1102615323 12:114149063-114149085 CTGTTTAACTTTATGATCTGGGG + Intergenic
1105946340 13:25193012-25193034 CATTTCACATTTTGGCTCTGCGG - Intergenic
1106359518 13:29017733-29017755 CATTTCACCTTTTTGAGCTGAGG + Intronic
1111717479 13:91897107-91897129 CAGTTCCATTTTATGGTCTGTGG - Intronic
1113339385 13:109407386-109407408 CACTTAATATTAATGATCTGTGG - Intergenic
1113726229 13:112604643-112604665 CAATGCACATTTATTATCTTAGG - Intergenic
1113873118 13:113575804-113575826 CAGTTCACTGTTCTGAACTGGGG + Intergenic
1115032965 14:28820014-28820036 CAGTTCACACTTAAGGACTGAGG - Intergenic
1115376279 14:32680089-32680111 CAGGGCAGATTTATGATTTGTGG - Intronic
1115902118 14:38163465-38163487 TTGTTTACATTTTTGATCTGAGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117941058 14:60965660-60965682 CAATTCTCATTTATGATGTTTGG + Intronic
1120181788 14:81351080-81351102 CAGTTCAGAATTATGACCGGAGG + Intronic
1122025882 14:98875591-98875613 TTGTTCACATTTATCATCTCAGG - Intergenic
1123112926 14:105881454-105881476 CAGGACACATTTAGGATCTGAGG - Intergenic
1123965437 15:25451221-25451243 CAACTCACATTCAGGATCTGAGG - Intergenic
1125927882 15:43578156-43578178 CTGATAACATTTATGATCTTAGG - Exonic
1125941025 15:43677721-43677743 CTGATAACATTTATGATCTTAGG - Intergenic
1128172508 15:65525431-65525453 TAGTTCACACTTCTGAACTGTGG + Intergenic
1129101842 15:73272505-73272527 CAATTCACAATTATGGTCTTAGG - Exonic
1132294993 15:100728274-100728296 CAGATAACTTTTATGACCTGAGG - Intergenic
1135055059 16:19224972-19224994 CACTTAACATCTATGAACTGGGG + Intronic
1137834045 16:51573430-51573452 CAGTTTCCATTTGTGACCTGTGG + Intergenic
1139218842 16:65158117-65158139 CAGTTCACAGTTAATTTCTGTGG - Intergenic
1143832961 17:9667006-9667028 CAGCTCACATTTACCTTCTGTGG - Intronic
1146296334 17:31653550-31653572 CTATTCATATTTATGCTCTGGGG + Intergenic
1146616684 17:34362327-34362349 CAGTTCACAGACCTGATCTGGGG + Intronic
1146628437 17:34452677-34452699 GAGTTCACAGCTATTATCTGTGG + Intergenic
1149338067 17:55658192-55658214 CAATGCTCATTGATGATCTGTGG - Intergenic
1153817267 18:8801284-8801306 CAGATCACAGTTCTGATGTGAGG - Intronic
1155525395 18:26711024-26711046 CAGTGCACAATTTTGATATGTGG + Intergenic
1156054611 18:32984942-32984964 CGGTTTTCATTTATGAGCTGTGG + Intronic
1156270215 18:35523738-35523760 CAGTCCTCATTTATGAGATGGGG + Intergenic
1156906956 18:42364243-42364265 CAGTCCACATTTCTGAGCTGTGG + Intergenic
1158010240 18:52719924-52719946 CAGTTCACAGTCAGGATTTGGGG + Intronic
1158576038 18:58638897-58638919 CATTTCAGCTTTATGATATGGGG - Intergenic
1160610514 18:80081192-80081214 CAATTCACATTTCTCATATGAGG - Intronic
1163321997 19:16580247-16580269 CAGCACACATTTATCATCTTAGG + Intronic
1167406098 19:49309810-49309832 CCGTTCACATTCAGGATCTGGGG + Exonic
1168098157 19:54127137-54127159 CAGTACAGGTTTATTATCTGTGG + Intronic
1168626514 19:57922535-57922557 CAGTTCATATTTATAATCTTGGG + Exonic
925179594 2:1808476-1808498 CAGTCCACCCTCATGATCTGGGG - Intronic
927124885 2:20004936-20004958 CTGATCAGAATTATGATCTGTGG - Intronic
927362177 2:22248829-22248851 CATTTCACATTTCTATTCTGAGG + Intergenic
930374929 2:50552727-50552749 AAGTCCACCTTTATCATCTGTGG + Exonic
932007557 2:67941941-67941963 GATTCCACATTTAAGATCTGAGG - Intergenic
932282623 2:70507333-70507355 GTGTTCACATTAATGATCTCTGG - Intronic
934050434 2:88206029-88206051 CAGTTCACACCTATGGTCTTGGG + Intergenic
934220797 2:90080627-90080649 CAGTCCCCATCTGTGATCTGGGG - Intergenic
935704251 2:105841965-105841987 CATTTTACATTTCTGATCTCTGG - Intronic
935729446 2:106053315-106053337 CAGTTCACATTTTTGTACTTGGG - Intergenic
937709776 2:124966590-124966612 CACTTCTCATTTGTGATCTAAGG - Intergenic
937731287 2:125233503-125233525 CAATTCAAATTAATGATCTGTGG - Intergenic
939383220 2:141463364-141463386 CATTTGTCATTTATGATTTGTGG - Intronic
941090014 2:161163986-161164008 CAGTTTGCATCTATGAACTGTGG + Intronic
941463392 2:165796575-165796597 CATTTCAGATTTTGGATCTGTGG + Intergenic
944037828 2:195317713-195317735 TAGTTCACCTTTATCAGCTGTGG - Intergenic
945058946 2:205891825-205891847 CAGTTCCCTTTTGTTATCTGGGG - Intergenic
946521345 2:220468215-220468237 CAGGTCACGTTTATGACCTATGG - Intergenic
948002266 2:234577878-234577900 CAGTTCATCTTCATGATCTTTGG + Intergenic
1172375553 20:34436645-34436667 CTGTCCACATATATAATCTGGGG + Intronic
1174440823 20:50551570-50551592 CATTTGACATCTATGATGTGTGG + Intronic
1175614429 20:60382707-60382729 CAGTTCCCATTCATTCTCTGAGG + Intergenic
1177247767 21:18552048-18552070 CAGTTCACATTTATAGTTAGAGG + Intergenic
1183068640 22:35381056-35381078 CCGGTCACATTTATGCTCGGCGG - Exonic
954188520 3:48939325-48939347 CTGATCTCATTTATCATCTGGGG + Intronic
958006297 3:87815585-87815607 CAGTTTACCTTGATGATCTAAGG + Intergenic
959405476 3:105957716-105957738 CAGTTCCCTTTTATGTTCGGGGG - Intergenic
960482067 3:118204010-118204032 CAGTTCACATTTTAGAAGTGGGG + Intergenic
961383792 3:126512905-126512927 CACTTCAGATTTCTGATCTCTGG + Intronic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
963580145 3:147115769-147115791 CAATTCAAATTTATAATCTTAGG - Intergenic
964348846 3:155782932-155782954 CAGTTCAGATTTCAGATTTGTGG - Intronic
967408409 3:189142509-189142531 CAGCTCTGATTTGTGATCTGTGG + Intronic
969999989 4:11355352-11355374 GAGTTCACATTTAAGGACTGAGG - Intergenic
972256013 4:37356360-37356382 CAGTACAGATCTATGACCTGGGG - Exonic
974790776 4:66685507-66685529 GAGATAACATTTATAATCTGAGG + Intergenic
980091889 4:128451494-128451516 CAGTTCACATTTACGGGCAGGGG + Intergenic
980475908 4:133315944-133315966 CAGTTTATCTTTATCATCTGGGG + Intergenic
980722078 4:136711432-136711454 CATTTCACATATCTGAACTGGGG - Intergenic
980745987 4:137016618-137016640 CAGTTAATATTTATGATCATTGG - Intergenic
982039531 4:151382620-151382642 CAGTTAACATATAGAATCTGAGG - Intergenic
984409865 4:179383335-179383357 CAGTTCATATTTATCCTCAGTGG - Intergenic
984434759 4:179695442-179695464 CAGTTTATATTTTTGAACTGTGG + Intergenic
986112518 5:4733981-4734003 CAGGTCATGTTTAGGATCTGGGG - Intergenic
986763370 5:10900142-10900164 CAATACATATTTATAATCTGTGG + Intergenic
989292077 5:39779679-39779701 CAGTTCACATTTGTAATTTATGG - Intergenic
989978861 5:50617305-50617327 CAAGGCACATTTATCATCTGGGG - Intergenic
994622802 5:102182863-102182885 TGGTTAACATTTATGATCAGTGG - Intergenic
995558636 5:113356880-113356902 CATTTCACATATATTATCTTTGG + Intronic
995815392 5:116161882-116161904 CAGTGCACACCTATGTTCTGTGG + Intronic
995950192 5:117702888-117702910 CAATTAACATTTATGAACTAAGG - Intergenic
996044855 5:118860439-118860461 CAGTCCACATTTTTGATATTTGG + Intronic
1001693970 5:173655849-173655871 CAGTTGACAATAAAGATCTGGGG + Intergenic
1003723732 6:8735355-8735377 CAGTTGACATTAATGAACTTTGG + Intergenic
1005271802 6:24173228-24173250 CTGTTTACACTTCTGATCTGTGG + Exonic
1006202688 6:32310311-32310333 CAGTGGACCATTATGATCTGAGG + Intronic
1006323671 6:33336798-33336820 CTTTTAACATTTATGATATGTGG + Intergenic
1008431996 6:51429283-51429305 CATTTCTCATTCATTATCTGGGG - Intergenic
1008746516 6:54676468-54676490 CAGATCACATTAATGATTTTTGG + Intergenic
1011530354 6:88314429-88314451 CATTCCACATTAATTATCTGTGG - Intergenic
1014189696 6:118480362-118480384 GATTTCACGTTTATGATCTAAGG + Intronic
1014196698 6:118568251-118568273 CAGTTCTCATATATGATTTGAGG + Intronic
1015168019 6:130220518-130220540 CAGTTCACAGTTACCATCTCTGG - Intronic
1015194216 6:130507698-130507720 GAGATCTCATTTATTATCTGTGG + Intergenic
1015586221 6:134779204-134779226 CAGTTCAGATTCAAGATGTGGGG - Intergenic
1015721902 6:136250894-136250916 CAGTTTTCATTTCTGATTTGAGG + Intergenic
1017585896 6:155922321-155922343 CAGTTCCCATATATGATCATAGG + Intergenic
1021392594 7:20112086-20112108 TAGTTCCCATATAGGATCTGAGG + Intergenic
1022160143 7:27702094-27702116 CAGTTCTGGTTTATGATGTGAGG + Intergenic
1028765815 7:94558631-94558653 CAAATCACAATTATGATTTGGGG - Intergenic
1031541761 7:123003842-123003864 CAGTACATATTTCTGTTCTGTGG + Intergenic
1032347518 7:131130506-131130528 CACTTGACATTTATGACCTCAGG - Intronic
1032844569 7:135741554-135741576 CAGCTCACACTTATAATCTCAGG + Intronic
1034520360 7:151614660-151614682 CAGCTCGCAGTGATGATCTGTGG + Intronic
1035342151 7:158169603-158169625 CAGTTCTCATATATGAACTTGGG + Intronic
1035551887 8:534806-534828 CAGTTCATATTCATTATTTGTGG - Intronic
1036926182 8:12908409-12908431 CAGTTCAGAATTATTAACTGTGG - Intergenic
1039841803 8:41298934-41298956 AAGTTCACCTTTATTTTCTGAGG - Intronic
1041002116 8:53463579-53463601 AAGTTCAGATTTGTGGTCTGTGG - Intergenic
1045075639 8:98563943-98563965 CAGCTCACATTTAAGAAGTGGGG - Intronic
1047345138 8:124020493-124020515 CAGCTCACATTTATGTGCTTAGG - Intronic
1047436504 8:124839410-124839432 CAGGTCACATTTTTGAAATGGGG - Intergenic
1049034241 8:140062066-140062088 CAGTTCACCCTTCTGACCTGAGG + Intronic
1050208202 9:3221235-3221257 CATTTCAAATATATCATCTGAGG + Exonic
1050290724 9:4151621-4151643 CAGTTCACAGTTTTGCACTGAGG + Intronic
1056889924 9:90482281-90482303 GAGTTCTAATTTATGTTCTGAGG + Intergenic
1057005093 9:91550217-91550239 CATTTCACATTTATTTCCTGTGG + Intergenic
1057337142 9:94165193-94165215 ACGTTTACATTTATGATCTTAGG - Intergenic
1059530443 9:115030604-115030626 CAGTTCTTTTTTCTGATCTGAGG + Intronic
1059694979 9:116722452-116722474 CTGGCCACTTTTATGATCTGGGG - Intronic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1189139544 X:38587302-38587324 CAGTTCACATTTATGATCTGTGG + Intronic
1189163612 X:38836935-38836957 TATTTCACATTTATTATCTATGG - Intergenic
1191976733 X:66880584-66880606 AAGGTCACATTTCTGATCAGTGG + Intergenic
1195272300 X:103243653-103243675 CAGTTCAAGTTTATGCTCTTAGG + Intergenic
1196286158 X:113882739-113882761 CAGTTCACATCTATCATGAGTGG + Intergenic
1199762152 X:150913132-150913154 GAGTTGCCATTTATGAGCTGGGG - Intergenic