ID: 1189147473

View in Genome Browser
Species Human (GRCh38)
Location X:38669904-38669926
Sequence GACTCTCCCATTTTGCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189147473_1189147476 21 Left 1189147473 X:38669904-38669926 CCCATCAGCAAAATGGGAGAGTC 0: 1
1: 0
2: 0
3: 25
4: 265
Right 1189147476 X:38669948-38669970 ATTGCATTTTGTATGAAGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 323
1189147473_1189147475 20 Left 1189147473 X:38669904-38669926 CCCATCAGCAAAATGGGAGAGTC 0: 1
1: 0
2: 0
3: 25
4: 265
Right 1189147475 X:38669947-38669969 AATTGCATTTTGTATGAAGTTGG 0: 1
1: 0
2: 1
3: 31
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189147473 Original CRISPR GACTCTCCCATTTTGCTGAT GGG (reversed) Intronic
900233829 1:1576928-1576950 GACTATCCCAGTTTGCATATTGG + Intergenic
901623821 1:10611597-10611619 AACTCTTACATATTGCTGATGGG - Intronic
902954599 1:19916711-19916733 GCCTCTCCAATTTTGATGAGAGG - Intergenic
903008493 1:20314222-20314244 GAGTGGCCCATTTTGCTGATGGG - Intronic
903086160 1:20861413-20861435 GACCCTCCTATTCTGCTGCTGGG - Intronic
903821117 1:26103332-26103354 GACCCCCTCATTTTGCAGATGGG + Intergenic
903861769 1:26368716-26368738 AACCTTCCCATTTTGCGGATAGG - Intronic
904369731 1:30040734-30040756 GACTTCCTCATTTTGCAGATGGG - Intergenic
904720658 1:32505498-32505520 AACTCTCACAAATTGCTGATAGG + Intronic
904752914 1:32752271-32752293 GACTCTCACATTTTGCAGGGAGG + Intronic
906684727 1:47756038-47756060 TCCTCTCCCATTTTATTGATGGG + Intergenic
909135756 1:71798575-71798597 TTCACTCCTATTTTGCTGATGGG + Intronic
910824353 1:91389850-91389872 AACTCTCAAATATTGCTGATGGG + Intronic
911301546 1:96180532-96180554 TACCCTCACATTTTGCTGACAGG - Intergenic
911700063 1:100942203-100942225 TACTCTCATACTTTGCTGATAGG + Intronic
912643713 1:111371214-111371236 TACTCTCCCAGTTTGCTGACTGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915014238 1:152718620-152718642 GACTTACCCTCTTTGCTGATAGG - Intergenic
916417438 1:164605510-164605532 GTCTCTCCAGTTTTCCTGATTGG + Intronic
916993630 1:170271773-170271795 GTCTCAACCATGTTGCTGATGGG - Intergenic
922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG + Intronic
922983477 1:229848349-229848371 GATGCTCCCATTTTACAGATGGG - Intergenic
924933562 1:248749242-248749264 AAATCCCCCATTTTGCTGTTAGG - Intronic
1062931696 10:1357098-1357120 GTCTCTGCCCTTTTGCTGACAGG - Intronic
1063498828 10:6535325-6535347 GAATCTCCCATTATGAGGATTGG - Intronic
1063949396 10:11208168-11208190 CACCCTCCCATTTTACAGATGGG - Intronic
1065066931 10:21978377-21978399 GACTTTCCCACTTTACTGAAAGG - Intronic
1065897314 10:30175414-30175436 CTCTCTCCCATGTTGCTGGTGGG - Intergenic
1068388267 10:56359932-56359954 AGGTCTCCCATTTGGCTGATGGG - Intronic
1068574095 10:58664173-58664195 AACTCTCCTATATTGCTGGTGGG - Intronic
1069724462 10:70568328-70568350 TATTCTCCCATTTTACAGATGGG - Exonic
1070279359 10:75037621-75037643 GTCCCTCCCATTTTGCTGAGAGG + Intergenic
1070411829 10:76149007-76149029 AACTCTACTATTTTGCTGGTGGG - Intronic
1070757797 10:79004204-79004226 GACACTCCCATTTGACAGATGGG - Intergenic
1072761552 10:98060938-98060960 GAGTTTCCCATTTTACAGATGGG + Intergenic
1074836172 10:117297291-117297313 AACTCTCCTATATTGCTGATGGG + Intronic
1075012272 10:118884837-118884859 AACTCTCATATGTTGCTGATAGG + Intergenic
1075687298 10:124373236-124373258 CACTCTCTCACTTTGCTGATGGG - Intergenic
1076737652 10:132465966-132465988 CACGCTCCCATTTTACAGATGGG + Intergenic
1077470399 11:2756058-2756080 GTCTCTCCTACATTGCTGATGGG + Intronic
1077789614 11:5424382-5424404 GACTCTTTCATCTTGCTGAAAGG - Intronic
1079006386 11:16794250-16794272 AACTCTCCCATTTTGCAGTTGGG - Intronic
1081730904 11:45371124-45371146 CAATCTCCCATCTTGATGATGGG - Intergenic
1083572209 11:63766822-63766844 GAGACTCCCATTTTGGGGATGGG + Intronic
1084773315 11:71358063-71358085 TACTCTCCCATAATGCAGATGGG - Intergenic
1085741335 11:79080523-79080545 GCCTCTCCCATTGTGTTGACTGG + Intronic
1085744915 11:79106664-79106686 AACTCTCCCACTTTACAGATGGG + Intronic
1085795624 11:79536985-79537007 TAGTCTCCCATCTTGCTGAATGG - Intergenic
1086414914 11:86578904-86578926 GTCATTCCCATTTTGCAGATAGG + Intronic
1086855513 11:91860725-91860747 GTCTCTGCCATTTTGAGGATAGG + Intergenic
1088068764 11:105755373-105755395 AACTCTCCCATTTTTCTTTTGGG + Intronic
1088081170 11:105916299-105916321 GCATTTCCCATTTTGCAGATGGG - Intronic
1088581662 11:111322147-111322169 GGCGCTCTCATTTTGCTGAGTGG - Intergenic
1089603822 11:119630207-119630229 CACCCTCCTATTTTGCTGAAGGG - Intronic
1089824256 11:121259433-121259455 AACTCTCAAATATTGCTGATGGG - Intergenic
1089890314 11:121874144-121874166 TATTTTCACATTTTGCTGATTGG + Intergenic
1090659811 11:128873689-128873711 GTCTGTCCCATTTTCCTGAGAGG - Intergenic
1091704453 12:2684296-2684318 CACCGTCCCATTTTGCTGATGGG - Intronic
1091711027 12:2740646-2740668 CACCGCCCCATTTTGCTGATGGG - Intergenic
1092527235 12:9316723-9316745 TTCTCTCCCATTCTACTGATTGG - Intergenic
1092540038 12:9415050-9415072 TTCTCTCCCATTCTACTGATTGG + Intergenic
1093970864 12:25374777-25374799 TGCACTCCCATTTTGCAGATTGG + Intergenic
1094474353 12:30829876-30829898 CACCATCCTATTTTGCTGATGGG + Intergenic
1100301947 12:93315577-93315599 GTCTCTGCCATTTTGGTGATTGG - Intergenic
1101193237 12:102356333-102356355 TTCTCCCCCATTTTGCTGCTGGG + Intergenic
1101841385 12:108329851-108329873 TACACTCCCATTTTTCAGATGGG - Intronic
1101844098 12:108348775-108348797 AACACTCCCATTTTGCATATGGG + Intergenic
1102305386 12:111800699-111800721 AACCCTCCTATGTTGCTGATGGG + Intronic
1102445127 12:112996473-112996495 GAAACTCACATCTTGCTGATGGG - Intronic
1104531791 12:129578848-129578870 TACTCACCCACTTTGCTGACAGG + Intronic
1104613777 12:130252045-130252067 TACTCTTCCATTTTAGTGATTGG + Intergenic
1104852252 12:131882623-131882645 GTCCCTCCCATTTTCCTGAGGGG - Intergenic
1105402800 13:20110513-20110535 AACTCTCCTACTCTGCTGATGGG + Intergenic
1105732024 13:23227377-23227399 AACTCTCCTATATTGCTTATGGG + Intronic
1105900833 13:24751471-24751493 GACTCTTCCATTTCGGTGGTAGG + Intergenic
1106471516 13:30060253-30060275 GAGTCTCCCATTTTTCTAAGAGG + Intergenic
1107167186 13:37296554-37296576 AACTCTCATATATTGCTGATTGG - Intergenic
1107742784 13:43470900-43470922 AACTCTCACATTTTGTTGGTGGG + Intronic
1108134148 13:47337728-47337750 AACTCTCATATTTTGCTGGTTGG + Intergenic
1108426562 13:50307884-50307906 AACTCCCACAATTTGCTGATGGG + Intronic
1109459999 13:62644114-62644136 GACTCTCCCATGTGGGTGAGTGG - Intergenic
1110353075 13:74533388-74533410 CACTCTCATATATTGCTGATGGG - Intergenic
1110462833 13:75765045-75765067 GACTCTTTTATTTTCCTGATGGG - Intronic
1112279808 13:98052873-98052895 GACTCTTACATATTGCTGGTGGG - Intergenic
1115022851 14:28704008-28704030 TACTTTCCCATTTTGCTTCTAGG + Intergenic
1115428621 14:33290064-33290086 GAGTCTATCATTTTCCTGATGGG - Intronic
1115835919 14:37402450-37402472 GCCTTTCCTATTTTGCTCATTGG - Intronic
1115843394 14:37497802-37497824 GAAACTCATATTTTGCTGATGGG + Intronic
1116202137 14:41811301-41811323 GATTCTCATATATTGCTGATGGG + Intronic
1117136631 14:52741313-52741335 GACTCTCACACATTGCTGGTGGG - Intronic
1117573848 14:57077750-57077772 GGCTCTAACCTTTTGCTGATGGG - Intergenic
1118169245 14:63370086-63370108 GGTTCTCTCATTTGGCTGATAGG + Intergenic
1119428464 14:74550927-74550949 GACTCTCCCATTTCCCAGATGGG - Intronic
1119525602 14:75320207-75320229 GACTCTGCCATTCTGCTCCTAGG - Intergenic
1120351933 14:83372527-83372549 AACTCTCATATTTTGCTGGTGGG - Intergenic
1120893190 14:89507232-89507254 GTCTCTGCCATTATGCTGTTAGG - Intronic
1121019013 14:90567618-90567640 TAGTCTCCCATTTTACAGATAGG + Intronic
1121377652 14:93429361-93429383 GACTCTGACATCCTGCTGATTGG - Intronic
1126107878 15:45158783-45158805 GAGTCTCCCCTTCTGCTGCTGGG - Intronic
1126161173 15:45614909-45614931 GAGTCTCCCAGTTTGATGTTAGG + Intronic
1126357591 15:47812715-47812737 AACTCTCCCATTCTGCAGAGGGG - Intergenic
1128048577 15:64641801-64641823 GACTATCCCAAATTGCTTATTGG + Intronic
1129125718 15:73439433-73439455 AACTCTTATATTTTGCTGATGGG + Intergenic
1129232877 15:74206379-74206401 GAGCCTCCCATTTTGCAGATGGG - Intronic
1129877004 15:78982123-78982145 TACCCTCCCATTTTCCAGATGGG - Intronic
1129881614 15:79010380-79010402 CACTCTCCCATTTTGCAGACAGG - Intronic
1130373753 15:83309775-83309797 TACTCTCCCATTTTATAGATGGG - Intergenic
1130853807 15:87823168-87823190 GACACTCTCATTTTACAGATTGG - Intergenic
1131073543 15:89480590-89480612 CACCCTGGCATTTTGCTGATGGG - Intronic
1131822801 15:96290325-96290347 GACACTGTCATATTGCTGATAGG - Intergenic
1134742850 16:16563423-16563445 GATGCACCCATTTTGCAGATGGG + Intergenic
1134829622 16:17312711-17312733 TATTATCCCATTTTGCAGATGGG + Intronic
1134924710 16:18149043-18149065 GATGCACCCATTTTGCAGATGGG - Intergenic
1135187029 16:20323983-20324005 GACGCTCCCATGTGGCTGAATGG - Exonic
1135377483 16:21961171-21961193 GAATGTCTCATTCTGCTGATAGG + Intronic
1137052289 16:35724472-35724494 GTCTCTCCCATTTTGATGCCTGG + Intergenic
1137703828 16:50519791-50519813 GACTGTGCCATTTTACAGATGGG - Intergenic
1138082372 16:54102797-54102819 GACTCTCTAATTATGCTAATTGG + Intronic
1139783954 16:69375354-69375376 AACTCTCATATATTGCTGATGGG - Intronic
1140785202 16:78334763-78334785 GACTTTCCCATTTTCCTGGTGGG - Intronic
1140844099 16:78870379-78870401 GACCTTCCCATTTTGTAGATGGG + Intronic
1141110689 16:81268409-81268431 GACTCACTCCTTTTGCTGCTGGG - Intronic
1141991934 16:87615541-87615563 GGCTCCCCCATTTTCCAGATGGG + Intronic
1146199154 17:30840812-30840834 TTCTCTCCTATTTTGCTGTTTGG + Intronic
1147046229 17:37754472-37754494 GCCTCTCCAAGGTTGCTGATGGG + Intergenic
1148264103 17:46210681-46210703 GAATTCCCCATTTTGCAGATGGG + Intronic
1148326851 17:46788320-46788342 CAGTCTCCCATTTTACAGATTGG + Intronic
1148344944 17:46896984-46897006 GACTCTCCCACGTTCCTGAGGGG + Intergenic
1150286060 17:63954758-63954780 GGCTCTCCCAGTTTGCTCAGAGG - Intronic
1150869293 17:68887453-68887475 GACTCTCCCCTTCTGCTTACTGG - Exonic
1150960456 17:69906478-69906500 AATTGTCCCATTTTGCAGATCGG + Intergenic
1151250005 17:72826879-72826901 AACCCTCCTATATTGCTGATAGG + Intronic
1153522694 18:5967320-5967342 CACTTTCCCATTTTACTCATGGG - Intronic
1154979554 18:21491341-21491363 AATTCTCTCATTTTGCAGATGGG - Intronic
1156625962 18:38909400-38909422 GACTCCTTCATTTTGCTGGTGGG - Intergenic
1156891490 18:42194959-42194981 AACTCTCCTATATTGCTGGTTGG + Intergenic
1158171539 18:54605956-54605978 GACCCCCCCATTTGGCTAATAGG + Intergenic
1158253536 18:55517831-55517853 GACTCTCACACTTCCCTGATTGG - Intronic
1161261802 19:3341873-3341895 GCCTGTCCCATTTTACAGATGGG - Intergenic
1163433134 19:17280262-17280284 GATTCTCACATTTTGCAGATGGG + Intronic
1166969851 19:46559013-46559035 GACGCTCCCATGTTCGTGATGGG + Intronic
1168336749 19:55601279-55601301 ATCTGTCCCATTTTGCAGATGGG - Intronic
925316051 2:2924418-2924440 GACTCTCCTTCTTTGCTGGTGGG - Intergenic
925808305 2:7673942-7673964 GATTCTCCCCTTTTACTGGTCGG - Intergenic
926296567 2:11573181-11573203 GCCTCTCCCCTTCTGCTGAGAGG - Intronic
929809536 2:45178121-45178143 AACTCTCCCACACTGCTGATGGG + Intergenic
930144385 2:47986350-47986372 GACCCTCACACGTTGCTGATGGG - Intergenic
930898665 2:56476760-56476782 AACTCTGCCATTTTGCTTCTCGG - Intergenic
931881227 2:66573598-66573620 CATTCTCACCTTTTGCTGATGGG + Exonic
932297653 2:70640502-70640524 GGTTCTTCCATCTTGCTGATAGG + Intronic
937825035 2:126359632-126359654 GTCATTCCCATTTTGCAGATGGG - Intergenic
938387076 2:130874160-130874182 GAGCCTCCGTTTTTGCTGATAGG - Intronic
939293908 2:140232049-140232071 GACTCTCCACTTTTGATTATGGG + Exonic
939440502 2:142243502-142243524 AACTCTCACATATTGATGATGGG + Intergenic
939527231 2:143311582-143311604 CACTCTCCCATATTGCTGTTTGG - Intronic
940060611 2:149562126-149562148 GACTCTCCTAATTTGTTGAGAGG + Intergenic
941841738 2:170092482-170092504 GACTCTCCTACATTGCTGGTAGG + Intergenic
946430174 2:219622020-219622042 GACCCTCCTGCTTTGCTGATGGG + Intergenic
947317313 2:228874790-228874812 GACTCTACTATGTGGCTGATTGG + Intronic
947645204 2:231733838-231733860 GTCTCTCCCATTTTACAAATGGG - Intronic
1168924526 20:1568236-1568258 GACTCAGCCATTTTGCAGTTTGG - Intronic
1169417775 20:5432492-5432514 GACATGCCCATTTTGCAGATGGG + Intergenic
1169625927 20:7569001-7569023 GACTCTCAAATTTTTCTGTTTGG - Intergenic
1172186416 20:33033882-33033904 AAGCCTCCCATTTTGTTGATGGG + Intronic
1172382711 20:34509678-34509700 GACTCTGCCTTTTTGTTGGTAGG + Exonic
1172565534 20:35927409-35927431 GTGTATCCCATTTTGCAGATGGG + Intronic
1174984040 20:55429767-55429789 AATTCTCACACTTTGCTGATGGG + Intergenic
1175325403 20:58123589-58123611 GTCTCTCACACATTGCTGATGGG + Intergenic
1176444005 21:6802185-6802207 GCCTCTGGCATTTTGCTGAGGGG + Intergenic
1176822174 21:13667224-13667246 GCCTCTGGCATTTTGCTGAGGGG + Intergenic
1178099550 21:29252997-29253019 GAATCTCCCATTTTGGGGTTTGG + Intronic
1179575855 21:42308086-42308108 AATTGTCCCATTTTGCTGATAGG + Intergenic
1180882206 22:19213353-19213375 AACTCTCACATATTGCTGGTGGG + Intronic
1182048723 22:27297292-27297314 AACAGCCCCATTTTGCTGATGGG + Intergenic
1182547833 22:31085842-31085864 GAGGCTCCCATTTTCCAGATGGG + Intronic
1182814531 22:33148691-33148713 AACTCTCAAATATTGCTGATGGG - Intergenic
1183027908 22:35079962-35079984 GAGTCTCCCATTCTGCCAATGGG + Intronic
1185423668 22:50750074-50750096 GACTCTCATATACTGCTGATGGG - Intergenic
949783747 3:7718126-7718148 CATTCTCCCATTTTGCAGATGGG - Intronic
950450014 3:13060223-13060245 TACTCTCCCATGGTGCTGACTGG - Intronic
950538972 3:13598764-13598786 GACCCTCCCAATCTGGTGATTGG + Intronic
950563628 3:13750755-13750777 TGCTCTCCCATTGTGCAGATGGG - Intergenic
951148781 3:19262533-19262555 GACTTCCCCATTTGGCTGTTAGG + Intronic
952890232 3:38035009-38035031 AACTCTCACATTTTGCAAATGGG + Intergenic
955962425 3:64354639-64354661 TACTATTCCATTTTACTGATGGG + Intronic
956324904 3:68041483-68041505 TTTTCTCCCATTTTCCTGATAGG + Intronic
957216268 3:77324060-77324082 GGGTCTCCCAATTTGCTGCTTGG + Intronic
960112116 3:113855356-113855378 CACTCTCCCATGTAGCTCATGGG - Intronic
961119690 3:124363277-124363299 GCAACTCCCATTTTGTTGATGGG - Intronic
961328304 3:126124540-126124562 TACTCTCCCAGCTTGCTGCTGGG - Intronic
962027099 3:131559368-131559390 GACTCTCCCATTCTAGTAATAGG + Intronic
962875141 3:139530334-139530356 TACTCTCCCATTTTACAGACAGG - Intronic
962973626 3:140427357-140427379 GCCTCTCCCATTTGGCACATGGG + Intronic
965108834 3:164394704-164394726 AACCCTCCCACATTGCTGATGGG + Intergenic
967324670 3:188227415-188227437 GACTCTTCCAGTCTGCTCATAGG - Intronic
969094546 4:4722413-4722435 GACTCTCCCAGTTTTTTCATTGG + Intergenic
969835212 4:9834902-9834924 GGCTCTCCAACTTTGCTGTTGGG - Exonic
970581389 4:17477240-17477262 AGCACTCCCATTTTACTGATAGG + Intronic
975386059 4:73761615-73761637 AACTCTCAGACTTTGCTGATAGG + Intergenic
975760568 4:77615721-77615743 AACTCTCACATATTGCTGATGGG - Intergenic
975760949 4:77619047-77619069 GATTCTCCAATGTTGCTGGTTGG - Intergenic
977917305 4:102608472-102608494 CTCTCTCCTATTTTGCTCATAGG + Intronic
978040807 4:104058908-104058930 GACCCTGCCATCTTGCTGAGGGG - Intergenic
979688339 4:123536318-123536340 GACTCACCCAATTTCCTCATAGG - Intergenic
981459399 4:144995481-144995503 GTCTCTTCCATTCTGGTGATTGG + Exonic
982851109 4:160317249-160317271 TACTGGCCCATTATGCTGATTGG - Intergenic
983617599 4:169725223-169725245 AACTGTCCCGTGTTGCTGATAGG + Intergenic
984008302 4:174340256-174340278 TACTCTCACATGCTGCTGATAGG - Intergenic
984598958 4:181704610-181704632 AATTCTCCCATTTTGATCATTGG + Intergenic
986282480 5:6334943-6334965 GCCTCTCCCATCCTGCTAATGGG - Intergenic
990616291 5:57511756-57511778 TTTTCTCCCATTTTACTGATGGG - Intergenic
993851249 5:93012628-93012650 TACTATCTCATTTTACTGATGGG + Intergenic
995310332 5:110703303-110703325 GACAGACCTATTTTGCTGATGGG + Intronic
996722175 5:126640535-126640557 GACACAGCCATATTGCTGATAGG + Intergenic
996735006 5:126750374-126750396 GACTCTCCCTTTTTGTTCTTTGG - Intergenic
997379435 5:133424803-133424825 TATTCTCCCATTTTCCAGATGGG - Intronic
998380598 5:141722414-141722436 GACTTTCCCATCTTGTTGATGGG + Intergenic
998535593 5:142927773-142927795 GACTCTCATACATTGCTGATGGG - Intronic
998732188 5:145091368-145091390 GACCCTTCAATTTTACTGATAGG - Intergenic
998905942 5:146905175-146905197 GACTCTCATACTTTGCTGGTGGG + Intronic
1001268650 5:170294041-170294063 AACCCTCACATTTTGCAGATGGG + Intronic
1004035967 6:11924318-11924340 GACTCTCCTACATTGCTGGTGGG + Intergenic
1004234943 6:13866804-13866826 ACCACTCCCATTTTGCAGATGGG - Intergenic
1005214936 6:23514636-23514658 GACTTTCCCATTTTCCTGTTGGG - Intergenic
1005678610 6:28182372-28182394 GATTCTTCCATCTTGCTGGTGGG - Intergenic
1006376141 6:33672711-33672733 AATTCTCCCATTTTACAGATGGG + Intronic
1007451388 6:41942044-41942066 GGCCCTCCCATTTTGCTTCTCGG + Intronic
1008809186 6:55472232-55472254 TACTCTCACATATTGCTGTTGGG - Intronic
1008846757 6:55975719-55975741 GACTCTTACATTTTGTTCATTGG + Intergenic
1009576040 6:65461819-65461841 GACTCTCATACTTTACTGATAGG + Intronic
1009640807 6:66333498-66333520 AACTCTCCTACTTTGCTGACGGG + Intergenic
1011556788 6:88577848-88577870 AACTCTCACATTTTGCTGTTGGG - Intergenic
1011752515 6:90467632-90467654 AACTCTCACATATTACTGATGGG - Intergenic
1012064625 6:94534763-94534785 GACTTTCCCATTTGGCTTAGTGG + Intergenic
1012531311 6:100240828-100240850 AACTCTCACATATTGTTGATAGG + Intergenic
1015809913 6:137151914-137151936 AACTCTCATATATTGCTGATGGG + Intronic
1016230318 6:141795845-141795867 TACTCTCAGATTTTGCTGGTGGG - Intergenic
1016435169 6:144029675-144029697 ATCTCTCACATATTGCTGATCGG + Intronic
1017030868 6:150220382-150220404 GACTTTACCATTTAGCTGTTTGG + Intronic
1018004453 6:159608525-159608547 AACTCTCTCATTTTCCTGATTGG + Intergenic
1018169634 6:161134557-161134579 GTCACCCCCATTTTGCAGATGGG + Exonic
1018406248 6:163485652-163485674 TTCTCTCCCATTGTGTTGATGGG + Intronic
1021161911 7:17284447-17284469 GACTTTCATATGTTGCTGATGGG + Intergenic
1021781069 7:24106554-24106576 GTCTCTCCTATATCGCTGATGGG - Intergenic
1023239374 7:38127487-38127509 GATCTGCCCATTTTGCTGATTGG + Intergenic
1023756365 7:43421812-43421834 GACTCTCCAACTCTGCTGATAGG + Intronic
1023887694 7:44372972-44372994 GACCATCCCATTTTGCTAAAAGG + Intergenic
1026967302 7:74448320-74448342 GACTATCCCATTTCACAGATGGG - Intergenic
1027262294 7:76473507-76473529 AACTCTCCCATTTTGCAGTCAGG + Intronic
1027313675 7:76971604-76971626 AACTCTCCCATTTTGCAGTCAGG + Intergenic
1028254661 7:88579131-88579153 AACTCTCACATATTGCTGATGGG - Intergenic
1028512792 7:91643648-91643670 GACTCTCCCATTTCTCTATTTGG - Intergenic
1031109449 7:117588794-117588816 GACTCTACCATTTTCCTGTATGG - Intronic
1031241831 7:119254707-119254729 AATCCTCCCATTTTGCAGATAGG + Intergenic
1032113478 7:129096915-129096937 AACTCTCATATATTGCTGATGGG - Intergenic
1032211633 7:129919933-129919955 AACTCTCATATGTTGCTGATGGG + Intronic
1032372570 7:131373147-131373169 TACTCTTATATTTTGCTGATAGG - Intronic
1032559241 7:132871308-132871330 GAGACTGCCATTTTGCTGTTGGG - Intronic
1032611586 7:133420993-133421015 TACTATTCCATTTTGATGATAGG + Intronic
1033910290 7:146255330-146255352 GTGTCTACCACTTTGCTGATAGG + Intronic
1034222853 7:149459717-149459739 GGCTCTCCCATTTCGCAGAACGG - Intronic
1041918098 8:63156056-63156078 GTCATTCCCATGTTGCTGATGGG - Intergenic
1042888345 8:73577694-73577716 GACTGTCACATGCTGCTGATGGG - Intronic
1043423290 8:80122547-80122569 GACTCTGCCATTTAATTGATAGG - Intronic
1044764677 8:95558912-95558934 GAGTGTTCCATTTTGCTGAGTGG + Intergenic
1045323685 8:101101137-101101159 GAGTCAAGCATTTTGCTGATGGG - Intergenic
1047620249 8:126599106-126599128 AACTCTTGCATATTGCTGATCGG - Intergenic
1049972842 9:836508-836530 AACTCTCGTATATTGCTGATGGG - Intergenic
1050822797 9:9902446-9902468 GACTCTTGCATTTTAGTGATTGG - Intronic
1051006373 9:12350243-12350265 TACTTTCCCTTTTTGCTGAAAGG + Intergenic
1051408964 9:16769394-16769416 TTCTCTCCCATTTTACTGACAGG + Intronic
1053318438 9:37073231-37073253 AACTCTCTCATTTTGCAGAAGGG - Intergenic
1053322509 9:37112618-37112640 AACTCTCTCATTTTGCAGAAGGG - Intergenic
1054964174 9:71003547-71003569 CACTCTCCTACATTGCTGATGGG - Intronic
1055136677 9:72837225-72837247 AACTCTGCCATTTTGCTTAGTGG + Intergenic
1057488271 9:95503663-95503685 GATTGTCCCATTTTACAGATGGG - Intronic
1057820828 9:98329309-98329331 AAATCTCTCATTTTCCTGATGGG - Intronic
1059703443 9:116797965-116797987 AACTCTCCCCTTTTGTAGATGGG - Intronic
1061780436 9:132992947-132992969 CATTCTCCCATTTTACAGATGGG + Intergenic
1203525194 Un_GL000213v1:82342-82364 GCCTCTGGCATTTTGCTGAGGGG - Intergenic
1186851682 X:13586272-13586294 AACTCTCATATATTGCTGATGGG + Intronic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1189765193 X:44364764-44364786 AACTCTCATATATTGCTGATGGG + Intergenic
1192717915 X:73663418-73663440 GACTCCCCCATTGGGCTAATAGG + Intronic
1193796947 X:85888600-85888622 GACTCTGCCATTTTGCTCTTTGG - Intronic
1194750199 X:97675664-97675686 AACTCTCAAACTTTGCTGATGGG - Intergenic
1196268204 X:113678174-113678196 AACACTCATATTTTGCTGATAGG - Intergenic
1198692094 X:139295443-139295465 CATTCTCCCCTTTTGCTGAAAGG + Intergenic
1198797549 X:140414901-140414923 GACTCTCATATATTGCTGGTGGG + Intergenic
1199549481 X:149043011-149043033 GAGTTTCTCATTTTGCTGATAGG - Intergenic
1201437672 Y:13977030-13977052 AACTCTCCCATGTTGTTGGTGGG + Intergenic