ID: 1189148768

View in Genome Browser
Species Human (GRCh38)
Location X:38683526-38683548
Sequence GCACCATGGTATGATGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189148768_1189148770 -2 Left 1189148768 X:38683526-38683548 CCAGTGGCATCATACCATGGTGC 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1189148770 X:38683547-38683569 GCCCATACTGCTCACCCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 97
1189148768_1189148774 7 Left 1189148768 X:38683526-38683548 CCAGTGGCATCATACCATGGTGC 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1189148774 X:38683556-38683578 GCTCACCCATGTGGCCAGGCAGG 0: 1
1: 0
2: 1
3: 38
4: 701
1189148768_1189148777 16 Left 1189148768 X:38683526-38683548 CCAGTGGCATCATACCATGGTGC 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1189148777 X:38683565-38683587 TGTGGCCAGGCAGGTCCAGCAGG 0: 1
1: 0
2: 1
3: 39
4: 294
1189148768_1189148778 17 Left 1189148768 X:38683526-38683548 CCAGTGGCATCATACCATGGTGC 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1189148778 X:38683566-38683588 GTGGCCAGGCAGGTCCAGCAGGG 0: 1
1: 0
2: 10
3: 76
4: 417
1189148768_1189148773 3 Left 1189148768 X:38683526-38683548 CCAGTGGCATCATACCATGGTGC 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1189148773 X:38683552-38683574 TACTGCTCACCCATGTGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189148768 Original CRISPR GCACCATGGTATGATGCCAC TGG (reversed) Intronic
900947872 1:5841329-5841351 GCACCTTGGTCTGATGCCAAGGG + Intergenic
904432936 1:30476848-30476870 GTACAATGGGATGAAGCCACAGG + Intergenic
909455790 1:75847034-75847056 CCACCATGTTATGATGCAGCAGG - Intronic
914844462 1:151274229-151274251 GCCCAATGGTAAGATGCCATGGG + Intergenic
921316620 1:213897833-213897855 GTACCATTGTATCATGCCACAGG - Intergenic
922601852 1:226862156-226862178 CCACCATGTTATGATGCAGCGGG - Intergenic
1064946987 10:20801550-20801572 GCACAATGGTTTTATGCAACTGG + Intronic
1067992194 10:51227380-51227402 GCACCATGCTATTATAACACAGG - Intronic
1068130162 10:52886510-52886532 GCACCATGGTATGGTGGAGCAGG - Intergenic
1071700900 10:87934542-87934564 GCACCTTGGAATGATAGCACTGG + Intronic
1073682431 10:105718829-105718851 GCACCATGTTTTCATGCCTCTGG + Intergenic
1078858021 11:15222111-15222133 GCCCCATGATATGAGGCCAATGG - Intronic
1081038441 11:38179634-38179656 CCATCATGCTATGCTGCCACAGG - Intergenic
1083108869 11:60385623-60385645 GCACCACTGGTTGATGCCACAGG + Intronic
1085629346 11:78100783-78100805 TCACCATGGTGAGAAGCCACTGG - Intergenic
1087821890 11:102721851-102721873 GCATCATGGTGTGCTACCACTGG + Intronic
1089401774 11:118168520-118168542 GCCCCATGGCATGAAGCCCCTGG - Intronic
1090614773 11:128505023-128505045 ACACCATGGTATCATGCTATCGG - Intronic
1091658605 12:2363956-2363978 GCACGAGGGGATGATGGCACTGG - Intronic
1095255252 12:40027388-40027410 GCATCATGCTATCATGCTACAGG + Intronic
1099043460 12:77685354-77685376 TCACCATGATATGATGCCATTGG - Intergenic
1102892220 12:116568766-116568788 CCACCATGTTATGATGCAGCAGG + Intergenic
1104682468 12:130761157-130761179 GCACCATGGGAAGCTGTCACCGG - Intergenic
1109290808 13:60473139-60473161 CCACCATGTTATGATGCAGCAGG - Intronic
1113373084 13:109740318-109740340 GCACCATGGGATGCAGCCAGTGG + Intergenic
1115813060 14:37132069-37132091 CCACCATGGGATGATGCAGCAGG - Intronic
1127335779 15:57981962-57981984 TCACCATGGGATGACACCACAGG - Intronic
1127519909 15:59733640-59733662 CCACCATGGAATGATGCAGCAGG + Intergenic
1127874931 15:63103900-63103922 CCTCCATGGTATGAGGCCAAAGG - Intergenic
1130622248 15:85475802-85475824 GCACCATAGTTTGATGGCAAGGG - Intronic
1130853691 15:87822146-87822168 GCACCTCTGTATGATGCCAGAGG + Intergenic
1131381578 15:91968543-91968565 GCACCAGAATTTGATGCCACTGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1138275181 16:55729092-55729114 GCACCATGCTACGGTGCCCCTGG - Intergenic
1138311992 16:56033659-56033681 TCACCATATTGTGATGCCACAGG - Intergenic
1145306903 17:21680369-21680391 GCAGCACGGAATGATCCCACAGG + Intergenic
1145307130 17:21681534-21681556 GCAGCATGGAATGATCCCACAGG + Intergenic
1145307359 17:21682699-21682721 GCAGCACGGAATGATCCCACAGG + Intergenic
1145307583 17:21683864-21683886 GCAGCATGGAATGATCCCACAGG + Intergenic
1146274508 17:31508246-31508268 GGACCATGGTGTGATCCCACTGG - Intronic
1150357532 17:64499994-64500016 GCACAATGGTATGAACCAACAGG - Exonic
1155021959 18:21904757-21904779 CCACCATGTTATGCTGACACTGG - Intergenic
1167159971 19:47760911-47760933 GCACCATGGCAAAATCCCACTGG + Intergenic
1167372227 19:49090055-49090077 GCACTTTGGGATGATGACACAGG - Intronic
926046258 2:9711737-9711759 GTACCATGGGAGGATGCCAGTGG + Intergenic
928171093 2:29003440-29003462 TCACCATGGGATGTTGCCATAGG + Intronic
930804947 2:55480857-55480879 GTGCCATGGTATGATTACACTGG + Intergenic
938192066 2:129292573-129292595 GGATCAAGGTAAGATGCCACAGG + Intergenic
939165823 2:138640252-138640274 GCACCATGGGATGATGAAAAGGG + Intergenic
941716823 2:168772812-168772834 GCATCATTATATAATGCCACAGG + Exonic
1169241289 20:3983059-3983081 CCACCATGTTATGATGCAGCAGG + Intronic
1171347271 20:24475472-24475494 GCCCCATGGGATAATGGCACAGG + Intronic
1171465258 20:25323604-25323626 GCACCATTGTAAGATTGCACAGG - Intronic
1183430814 22:37764641-37764663 GCAAAATGTGATGATGCCACCGG + Intronic
954846904 3:53567150-53567172 GCACCATGCTATGCATCCACGGG - Intronic
957981352 3:87515508-87515530 GCACCATTGTATTATGCTACTGG - Intergenic
958692573 3:97486537-97486559 CCACCATGTTATGATGCAGCAGG - Intronic
968878914 4:3288649-3288671 GGACCCTGGCATGTTGCCACAGG + Intergenic
969979840 4:11143212-11143234 CCACCATGGTATGATGGTGCAGG + Intergenic
978239042 4:106493552-106493574 GCAACATCCTATCATGCCACTGG - Intergenic
980441491 4:132852641-132852663 GCACAATGGTGTGATTCTACAGG + Intergenic
983914153 4:173273340-173273362 GCACCTTGGTACAATGCCATTGG + Intronic
990070319 5:51774935-51774957 CCACCATGTTATGATGCAACAGG + Intergenic
995788172 5:115854050-115854072 TCACCATGTTATGATGCAGCAGG - Intronic
997078980 5:130715815-130715837 GCACCCTGGTATGATCCCTGAGG + Intergenic
1006824795 6:36926838-36926860 GCACCATGCCGTGATGCCGCAGG - Intronic
1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG + Intergenic
1026644553 7:72156371-72156393 GCACCATGGTCTGAAGATACAGG - Intronic
1030673895 7:112365175-112365197 TCCCCATGGTCTGATGCCATCGG + Intergenic
1035320358 7:158025335-158025357 CCCCCATGGTATGATACAACTGG + Intronic
1038200865 8:25411363-25411385 GCCCCATGGAATGAGGACACCGG - Exonic
1048183350 8:132216346-132216368 GCACCAGGGCTGGATGCCACAGG + Intronic
1048314654 8:133353040-133353062 ACTCCATGGTATCCTGCCACAGG - Intergenic
1049263272 8:141651433-141651455 GCCCCATGGTATCATGTCACTGG + Intergenic
1053303228 9:36966333-36966355 GCACCAGGGCAAGAAGCCACTGG + Intronic
1058752648 9:108053966-108053988 ACACCATGGAACGCTGCCACGGG - Intergenic
1062090794 9:134677857-134677879 GCCCCATGGCATGGTTCCACGGG + Intronic
1062566969 9:137167829-137167851 GCACCGTGGTGTGAGGCCCCCGG + Exonic
1189148768 X:38683526-38683548 GCACCATGGTATGATGCCACTGG - Intronic
1189712356 X:43826646-43826668 CCACCACGTTATGATGCCACAGG - Intronic
1197342805 X:125293593-125293615 CCACCATGGGATGATGCAGCAGG - Intergenic
1198816796 X:140600014-140600036 TCACCATGGTATCAGGCCACAGG - Intergenic
1199720658 X:150540913-150540935 GCAGCATGGTAGAATGCCAGGGG - Intergenic
1202183241 Y:22157367-22157389 TCTCCATGGTAGGATCCCACTGG + Intergenic
1202208118 Y:22429034-22429056 TCTCCATGGTAGGATCCCACTGG - Intergenic