ID: 1189152100

View in Genome Browser
Species Human (GRCh38)
Location X:38719513-38719535
Sequence CGGCGAACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189152090_1189152100 24 Left 1189152090 X:38719466-38719488 CCCTGCTGGATCTGGAGGGTTGG No data
Right 1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG No data
1189152092_1189152100 23 Left 1189152092 X:38719467-38719489 CCTGCTGGATCTGGAGGGTTGGA No data
Right 1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189152100 Original CRISPR CGGCGAACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr