ID: 1189153981

View in Genome Browser
Species Human (GRCh38)
Location X:38736643-38736665
Sequence ACAAGGGTACTGAACCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189153977_1189153981 24 Left 1189153977 X:38736596-38736618 CCTTTGCTGGAAAAAAAAAAAAC No data
Right 1189153981 X:38736643-38736665 ACAAGGGTACTGAACCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189153981 Original CRISPR ACAAGGGTACTGAACCCAGA AGG Intergenic
No off target data available for this crispr