ID: 1189154880

View in Genome Browser
Species Human (GRCh38)
Location X:38746704-38746726
Sequence GGCCTGTTACTGGGATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189154880_1189154884 -3 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG No data
1189154880_1189154888 26 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154880_1189154886 21 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154886 X:38746748-38746770 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322
1189154880_1189154887 25 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189154880 Original CRISPR GGCCTGTTACTGGGATTTGG TGG (reversed) Intergenic
No off target data available for this crispr