ID: 1189154884

View in Genome Browser
Species Human (GRCh38)
Location X:38746724-38746746
Sequence GCCAAGAACTGTCTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189154881_1189154884 -6 Left 1189154881 X:38746707-38746729 CCAAATCCCAGTAACAGGCCAAG No data
Right 1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG No data
1189154880_1189154884 -3 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG No data
1189154877_1189154884 19 Left 1189154877 X:38746682-38746704 CCCATAGTCAAACGTTCAGTTTC 0: 59
1: 183
2: 164
3: 74
4: 125
Right 1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG No data
1189154878_1189154884 18 Left 1189154878 X:38746683-38746705 CCATAGTCAAACGTTCAGTTTCC 0: 57
1: 181
2: 154
3: 82
4: 123
Right 1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189154884 Original CRISPR GCCAAGAACTGTCTCTCAAA AGG Intergenic
No off target data available for this crispr