ID: 1189154885

View in Genome Browser
Species Human (GRCh38)
Location X:38746725-38746747
Sequence TCCTTTTGAGAGACAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189154885_1189154888 5 Left 1189154885 X:38746725-38746747 CCAAGAACTGTCTCTCAAAAGGA No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154885_1189154887 4 Left 1189154885 X:38746725-38746747 CCAAGAACTGTCTCTCAAAAGGA No data
Right 1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG No data
1189154885_1189154886 0 Left 1189154885 X:38746725-38746747 CCAAGAACTGTCTCTCAAAAGGA No data
Right 1189154886 X:38746748-38746770 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189154885 Original CRISPR TCCTTTTGAGAGACAGTTCT TGG (reversed) Intergenic
No off target data available for this crispr