ID: 1189154888

View in Genome Browser
Species Human (GRCh38)
Location X:38746753-38746775
Sequence GTTATTTGCAGAAGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189154882_1189154888 17 Left 1189154882 X:38746713-38746735 CCCAGTAACAGGCCAAGAACTGT No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154885_1189154888 5 Left 1189154885 X:38746725-38746747 CCAAGAACTGTCTCTCAAAAGGA No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154881_1189154888 23 Left 1189154881 X:38746707-38746729 CCAAATCCCAGTAACAGGCCAAG No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154880_1189154888 26 Left 1189154880 X:38746704-38746726 CCACCAAATCCCAGTAACAGGCC No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data
1189154883_1189154888 16 Left 1189154883 X:38746714-38746736 CCAGTAACAGGCCAAGAACTGTC No data
Right 1189154888 X:38746753-38746775 GTTATTTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189154888 Original CRISPR GTTATTTGCAGAAGATGGCA GGG Intergenic
No off target data available for this crispr