ID: 1189158980

View in Genome Browser
Species Human (GRCh38)
Location X:38791134-38791156
Sequence GAATGTGAGCAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189158980_1189158990 29 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158990 X:38791186-38791208 GGACTTAACCAGGGGCTGGCTGG No data
1189158980_1189158985 19 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158985 X:38791176-38791198 CCTGTTACCAGGACTTAACCAGG No data
1189158980_1189158982 8 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158982 X:38791165-38791187 CTCTAGTTCCTCCTGTTACCAGG No data
1189158980_1189158986 20 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158986 X:38791177-38791199 CTGTTACCAGGACTTAACCAGGG No data
1189158980_1189158987 21 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158987 X:38791178-38791200 TGTTACCAGGACTTAACCAGGGG No data
1189158980_1189158988 25 Left 1189158980 X:38791134-38791156 CCATCTTCTCTCTGCTCACATTC No data
Right 1189158988 X:38791182-38791204 ACCAGGACTTAACCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189158980 Original CRISPR GAATGTGAGCAGAGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr