ID: 1189160588

View in Genome Browser
Species Human (GRCh38)
Location X:38804919-38804941
Sequence CCGCGCGGACGTTGGAGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 23}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189160588 Original CRISPR CCGCGCGGACGTTGGAGCGC AGG (reversed) Exonic