ID: 1189162418

View in Genome Browser
Species Human (GRCh38)
Location X:38823361-38823383
Sequence CTGAAGATAAAGATGTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189162415_1189162418 4 Left 1189162415 X:38823334-38823356 CCTTACAACAGGGGTACATAAGT No data
Right 1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189162418 Original CRISPR CTGAAGATAAAGATGTAAAA GGG Intergenic
No off target data available for this crispr