ID: 1189163940

View in Genome Browser
Species Human (GRCh38)
Location X:38840289-38840311
Sequence ATGGACAAGCATAAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189163933_1189163940 14 Left 1189163933 X:38840252-38840274 CCTGGATGAGCACTGGAATAAAT No data
Right 1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189163940 Original CRISPR ATGGACAAGCATAAAGAGGT GGG Intergenic
No off target data available for this crispr