ID: 1189164276

View in Genome Browser
Species Human (GRCh38)
Location X:38844950-38844972
Sequence CTGCTGGAATGAAGGACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189164276_1189164281 6 Left 1189164276 X:38844950-38844972 CCCATTGTCCTTCATTCCAGCAG No data
Right 1189164281 X:38844979-38845001 AGGTCCAATTTCATCTTTTGAGG No data
1189164276_1189164283 15 Left 1189164276 X:38844950-38844972 CCCATTGTCCTTCATTCCAGCAG No data
Right 1189164283 X:38844988-38845010 TTCATCTTTTGAGGCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189164276 Original CRISPR CTGCTGGAATGAAGGACAAT GGG (reversed) Intergenic
No off target data available for this crispr