ID: 1189170229

View in Genome Browser
Species Human (GRCh38)
Location X:38901837-38901859
Sequence TTACATAGAAGGTGCCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189170223_1189170229 4 Left 1189170223 X:38901810-38901832 CCCTTTTTGCCCTTCAGTCATAT No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170219_1189170229 28 Left 1189170219 X:38901786-38901808 CCTTATAAAAGAGGCCCCAGATT No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170226_1189170229 -5 Left 1189170226 X:38901819-38901841 CCCTTCAGTCATATGAGGTTACA No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170222_1189170229 12 Left 1189170222 X:38901802-38901824 CCAGATTGCCCTTTTTGCCCTTC No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170220_1189170229 14 Left 1189170220 X:38901800-38901822 CCCCAGATTGCCCTTTTTGCCCT No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170227_1189170229 -6 Left 1189170227 X:38901820-38901842 CCTTCAGTCATATGAGGTTACAT No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170224_1189170229 3 Left 1189170224 X:38901811-38901833 CCTTTTTGCCCTTCAGTCATATG No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data
1189170221_1189170229 13 Left 1189170221 X:38901801-38901823 CCCAGATTGCCCTTTTTGCCCTT No data
Right 1189170229 X:38901837-38901859 TTACATAGAAGGTGCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189170229 Original CRISPR TTACATAGAAGGTGCCATGC TGG Intergenic
No off target data available for this crispr