ID: 1189171877

View in Genome Browser
Species Human (GRCh38)
Location X:38917037-38917059
Sequence TGGTGACTCTCATTTACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189171877_1189171882 5 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171882 X:38917065-38917087 TGTTCTGGTCACCACCTATGGGG No data
1189171877_1189171883 13 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171883 X:38917073-38917095 TCACCACCTATGGGGCTTTTAGG No data
1189171877_1189171880 3 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171880 X:38917063-38917085 GCTGTTCTGGTCACCACCTATGG No data
1189171877_1189171881 4 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171881 X:38917064-38917086 CTGTTCTGGTCACCACCTATGGG No data
1189171877_1189171878 -10 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171878 X:38917050-38917072 AGAGTCACCAGTTGCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189171877 Original CRISPR TGGTGACTCTCATTTACCAA AGG (reversed) Intergenic
No off target data available for this crispr