ID: 1189171878

View in Genome Browser
Species Human (GRCh38)
Location X:38917050-38917072
Sequence AGAGTCACCAGTTGCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189171877_1189171878 -10 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171878 X:38917050-38917072 AGAGTCACCAGTTGCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189171878 Original CRISPR AGAGTCACCAGTTGCTGTTC TGG Intergenic