ID: 1189171882

View in Genome Browser
Species Human (GRCh38)
Location X:38917065-38917087
Sequence TGTTCTGGTCACCACCTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189171877_1189171882 5 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171882 X:38917065-38917087 TGTTCTGGTCACCACCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189171882 Original CRISPR TGTTCTGGTCACCACCTATG GGG Intergenic