ID: 1189171883 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:38917073-38917095 |
Sequence | TCACCACCTATGGGGCTTTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189171879_1189171883 | -7 | Left | 1189171879 | X:38917057-38917079 | CCAGTTGCTGTTCTGGTCACCAC | No data | ||
Right | 1189171883 | X:38917073-38917095 | TCACCACCTATGGGGCTTTTAGG | No data | ||||
1189171877_1189171883 | 13 | Left | 1189171877 | X:38917037-38917059 | CCTTTGGTAAATGAGAGTCACCA | No data | ||
Right | 1189171883 | X:38917073-38917095 | TCACCACCTATGGGGCTTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189171883 | Original CRISPR | TCACCACCTATGGGGCTTTT AGG | Intergenic | ||