ID: 1189171883

View in Genome Browser
Species Human (GRCh38)
Location X:38917073-38917095
Sequence TCACCACCTATGGGGCTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189171879_1189171883 -7 Left 1189171879 X:38917057-38917079 CCAGTTGCTGTTCTGGTCACCAC No data
Right 1189171883 X:38917073-38917095 TCACCACCTATGGGGCTTTTAGG No data
1189171877_1189171883 13 Left 1189171877 X:38917037-38917059 CCTTTGGTAAATGAGAGTCACCA No data
Right 1189171883 X:38917073-38917095 TCACCACCTATGGGGCTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189171883 Original CRISPR TCACCACCTATGGGGCTTTT AGG Intergenic