ID: 1189173637

View in Genome Browser
Species Human (GRCh38)
Location X:38932791-38932813
Sequence TCATTACCAAAAAGAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189173637_1189173638 0 Left 1189173637 X:38932791-38932813 CCTGGTTCTCTTTTTGGTAATGA No data
Right 1189173638 X:38932814-38932836 CACTATCATCTGTTTAATCATGG No data
1189173637_1189173639 3 Left 1189173637 X:38932791-38932813 CCTGGTTCTCTTTTTGGTAATGA No data
Right 1189173639 X:38932817-38932839 TATCATCTGTTTAATCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189173637 Original CRISPR TCATTACCAAAAAGAGAACC AGG (reversed) Intergenic
No off target data available for this crispr