ID: 1189173638

View in Genome Browser
Species Human (GRCh38)
Location X:38932814-38932836
Sequence CACTATCATCTGTTTAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189173637_1189173638 0 Left 1189173637 X:38932791-38932813 CCTGGTTCTCTTTTTGGTAATGA No data
Right 1189173638 X:38932814-38932836 CACTATCATCTGTTTAATCATGG No data
1189173635_1189173638 7 Left 1189173635 X:38932784-38932806 CCTCAATCCTGGTTCTCTTTTTG No data
Right 1189173638 X:38932814-38932836 CACTATCATCTGTTTAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189173638 Original CRISPR CACTATCATCTGTTTAATCA TGG Intergenic
No off target data available for this crispr