ID: 1189173639

View in Genome Browser
Species Human (GRCh38)
Location X:38932817-38932839
Sequence TATCATCTGTTTAATCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189173635_1189173639 10 Left 1189173635 X:38932784-38932806 CCTCAATCCTGGTTCTCTTTTTG No data
Right 1189173639 X:38932817-38932839 TATCATCTGTTTAATCATGGAGG No data
1189173637_1189173639 3 Left 1189173637 X:38932791-38932813 CCTGGTTCTCTTTTTGGTAATGA No data
Right 1189173639 X:38932817-38932839 TATCATCTGTTTAATCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189173639 Original CRISPR TATCATCTGTTTAATCATGG AGG Intergenic
No off target data available for this crispr