ID: 1189173699

View in Genome Browser
Species Human (GRCh38)
Location X:38933414-38933436
Sequence CTTACTCTGGTGGAGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189173692_1189173699 -8 Left 1189173692 X:38933399-38933421 CCTGCCCACATGGAGCTTACTCT No data
Right 1189173699 X:38933414-38933436 CTTACTCTGGTGGAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189173699 Original CRISPR CTTACTCTGGTGGAGGTGGT TGG Intergenic
No off target data available for this crispr