ID: 1189176705

View in Genome Browser
Species Human (GRCh38)
Location X:38964576-38964598
Sequence CTGGTCCTGCCGTTGACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189176697_1189176705 1 Left 1189176697 X:38964552-38964574 CCCCCATGATTCAATTACCTCCA 0: 380
1: 4487
2: 7434
3: 9048
4: 9127
Right 1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG No data
1189176699_1189176705 -1 Left 1189176699 X:38964554-38964576 CCCATGATTCAATTACCTCCACC 0: 366
1: 1871
2: 5651
3: 7847
4: 9624
Right 1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG No data
1189176700_1189176705 -2 Left 1189176700 X:38964555-38964577 CCATGATTCAATTACCTCCACCT 0: 404
1: 1922
2: 3919
3: 6561
4: 7729
Right 1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG No data
1189176698_1189176705 0 Left 1189176698 X:38964553-38964575 CCCCATGATTCAATTACCTCCAC 0: 355
1: 1915
2: 5589
3: 7796
4: 9847
Right 1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189176705 Original CRISPR CTGGTCCTGCCGTTGACACG TGG Intergenic
No off target data available for this crispr