ID: 1189179199

View in Genome Browser
Species Human (GRCh38)
Location X:38987413-38987435
Sequence GGCCAGGGCGAGCACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189179189_1189179199 17 Left 1189179189 X:38987373-38987395 CCAGGGAGCTTGGAGTGGCCGTG No data
Right 1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG No data
1189179187_1189179199 23 Left 1189179187 X:38987367-38987389 CCGGGGCCAGGGAGCTTGGAGTG No data
Right 1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG No data
1189179193_1189179199 -1 Left 1189179193 X:38987391-38987413 CCGTGGCTTGGCAGCTGAGAGGG No data
Right 1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189179199 Original CRISPR GGCCAGGGCGAGCACAGGCC TGG Intergenic
No off target data available for this crispr