ID: 1189179965

View in Genome Browser
Species Human (GRCh38)
Location X:38994490-38994512
Sequence GATTCAGAAGTGGCTCAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189179956_1189179965 29 Left 1189179956 X:38994438-38994460 CCTTATAATATCCATAATTGTGT No data
Right 1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG No data
1189179957_1189179965 18 Left 1189179957 X:38994449-38994471 CCATAATTGTGTATTATCTTTCA No data
Right 1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189179965 Original CRISPR GATTCAGAAGTGGCTCAGTT GGG Intergenic
No off target data available for this crispr