ID: 1189181353

View in Genome Browser
Species Human (GRCh38)
Location X:39007639-39007661
Sequence CTGGTTCTGAACATCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189181348_1189181353 7 Left 1189181348 X:39007609-39007631 CCTAGTTTCTCTGCTATGATCTG No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data
1189181343_1189181353 16 Left 1189181343 X:39007600-39007622 CCTCCCTCCCCTAGTTTCTCTGC No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data
1189181345_1189181353 12 Left 1189181345 X:39007604-39007626 CCTCCCCTAGTTTCTCTGCTATG No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data
1189181346_1189181353 9 Left 1189181346 X:39007607-39007629 CCCCTAGTTTCTCTGCTATGATC No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data
1189181347_1189181353 8 Left 1189181347 X:39007608-39007630 CCCTAGTTTCTCTGCTATGATCT No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data
1189181344_1189181353 13 Left 1189181344 X:39007603-39007625 CCCTCCCCTAGTTTCTCTGCTAT No data
Right 1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189181353 Original CRISPR CTGGTTCTGAACATCTATGT TGG Intergenic
No off target data available for this crispr