ID: 1189185596

View in Genome Browser
Species Human (GRCh38)
Location X:39052235-39052257
Sequence GGCTGGGTTGCTGCAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189185590_1189185596 12 Left 1189185590 X:39052200-39052222 CCATGGGAGGCTCTGGTTATGAA No data
Right 1189185596 X:39052235-39052257 GGCTGGGTTGCTGCAAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189185596 Original CRISPR GGCTGGGTTGCTGCAAATAG AGG Intergenic
No off target data available for this crispr