ID: 1189186911

View in Genome Browser
Species Human (GRCh38)
Location X:39062632-39062654
Sequence AGATGTACCTTGCAAGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189186904_1189186911 23 Left 1189186904 X:39062586-39062608 CCCAGCAAGAATTCCAGGCATAC No data
Right 1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG No data
1189186905_1189186911 22 Left 1189186905 X:39062587-39062609 CCAGCAAGAATTCCAGGCATACC No data
Right 1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG No data
1189186908_1189186911 1 Left 1189186908 X:39062608-39062630 CCTGCAAGCTCCTTTCATCTGGG No data
Right 1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG No data
1189186906_1189186911 10 Left 1189186906 X:39062599-39062621 CCAGGCATACCTGCAAGCTCCTT No data
Right 1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG No data
1189186910_1189186911 -9 Left 1189186910 X:39062618-39062640 CCTTTCATCTGGGTAGATGTACC No data
Right 1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189186911 Original CRISPR AGATGTACCTTGCAAGCTAG TGG Intergenic
No off target data available for this crispr