ID: 1189187686

View in Genome Browser
Species Human (GRCh38)
Location X:39068333-39068355
Sequence ATGACTTTCTAGAAAACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189187686_1189187692 19 Left 1189187686 X:39068333-39068355 CCTACAGTTTTCTAGAAAGTCAT No data
Right 1189187692 X:39068375-39068397 CCTGATTTGCAAATAAACATGGG No data
1189187686_1189187690 18 Left 1189187686 X:39068333-39068355 CCTACAGTTTTCTAGAAAGTCAT No data
Right 1189187690 X:39068374-39068396 TCCTGATTTGCAAATAAACATGG No data
1189187686_1189187687 -7 Left 1189187686 X:39068333-39068355 CCTACAGTTTTCTAGAAAGTCAT No data
Right 1189187687 X:39068349-39068371 AAGTCATCGAATCCAATTCCAGG No data
1189187686_1189187693 26 Left 1189187686 X:39068333-39068355 CCTACAGTTTTCTAGAAAGTCAT No data
Right 1189187693 X:39068382-39068404 TGCAAATAAACATGGGCCTCTGG No data
1189187686_1189187694 27 Left 1189187686 X:39068333-39068355 CCTACAGTTTTCTAGAAAGTCAT No data
Right 1189187694 X:39068383-39068405 GCAAATAAACATGGGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189187686 Original CRISPR ATGACTTTCTAGAAAACTGT AGG (reversed) Intergenic
No off target data available for this crispr