ID: 1189189132

View in Genome Browser
Species Human (GRCh38)
Location X:39082269-39082291
Sequence TTGCCCCTACCTCTAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189189132_1189189135 16 Left 1189189132 X:39082269-39082291 CCAGGGGTTAGAGGTAGGGGCAA No data
Right 1189189135 X:39082308-39082330 AATTTCATGAGTGAGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189189132 Original CRISPR TTGCCCCTACCTCTAACCCC TGG (reversed) Intergenic
No off target data available for this crispr