ID: 1189193000

View in Genome Browser
Species Human (GRCh38)
Location X:39127239-39127261
Sequence AAGGGCGGGAAGGGTTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189192992_1189193000 6 Left 1189192992 X:39127210-39127232 CCAAATACTCTCTGGGGAGGGGA No data
Right 1189193000 X:39127239-39127261 AAGGGCGGGAAGGGTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189193000 Original CRISPR AAGGGCGGGAAGGGTTTGAA AGG Intergenic
No off target data available for this crispr