ID: 1189194469

View in Genome Browser
Species Human (GRCh38)
Location X:39141025-39141047
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189194469_1189194477 22 Left 1189194469 X:39141025-39141047 CCAACGAGGTAAAATAGGGACCA No data
Right 1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG No data
1189194469_1189194472 -10 Left 1189194469 X:39141025-39141047 CCAACGAGGTAAAATAGGGACCA No data
Right 1189194472 X:39141038-39141060 ATAGGGACCAGGGCTCTTATAGG No data
1189194469_1189194474 1 Left 1189194469 X:39141025-39141047 CCAACGAGGTAAAATAGGGACCA No data
Right 1189194474 X:39141049-39141071 GGCTCTTATAGGTCCTCATCTGG No data
1189194469_1189194475 8 Left 1189194469 X:39141025-39141047 CCAACGAGGTAAAATAGGGACCA No data
Right 1189194475 X:39141056-39141078 ATAGGTCCTCATCTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189194469 Original CRISPR TGGTCCCTATTTTACCTCGT TGG (reversed) Intergenic
No off target data available for this crispr